ID: 1018903443

View in Genome Browser
Species Human (GRCh38)
Location 6:168062538-168062560
Sequence CCCTGATGCCCCCGAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903439_1018903443 -6 Left 1018903439 6:168062521-168062543 CCGTGAGGCCAGGACGGCCCTGA No data
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903433_1018903443 13 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903435_1018903443 7 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903432_1018903443 22 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903430_1018903443 27 Left 1018903430 6:168062488-168062510 CCACGCCTGCAGGGCCAGGGCCA 0: 1
1: 0
2: 8
3: 51
4: 432
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903428_1018903443 29 Left 1018903428 6:168062486-168062508 CCCCACGCCTGCAGGGCCAGGGC No data
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903438_1018903443 -5 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903429_1018903443 28 Left 1018903429 6:168062487-168062509 CCCACGCCTGCAGGGCCAGGGCC 0: 1
1: 0
2: 3
3: 41
4: 362
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903443 Original CRISPR CCCTGATGCCCCCGAGAGGC CGG Intronic