ID: 1018903447

View in Genome Browser
Species Human (GRCh38)
Location 6:168062546-168062568
Sequence CCCCCGAGAGGCCGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903438_1018903447 3 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903439_1018903447 2 Left 1018903439 6:168062521-168062543 CCGTGAGGCCAGGACGGCCCTGA No data
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903432_1018903447 30 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903435_1018903447 15 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903440_1018903447 -6 Left 1018903440 6:168062529-168062551 CCAGGACGGCCCTGATGCCCCCG No data
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903433_1018903447 21 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903447 Original CRISPR CCCCCGAGAGGCCGGCAGGA AGG Intronic