ID: 1018903800

View in Genome Browser
Species Human (GRCh38)
Location 6:168063861-168063883
Sequence CAACCTCGGTGGGCAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 274}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903789_1018903800 0 Left 1018903789 6:168063838-168063860 CCCCAGACTCCCACAGCTGGTGC 0: 1
1: 0
2: 10
3: 116
4: 566
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903787_1018903800 11 Left 1018903787 6:168063827-168063849 CCGAGAAGCTTCCCCAGACTCCC 0: 1
1: 0
2: 7
3: 35
4: 391
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903783_1018903800 20 Left 1018903783 6:168063818-168063840 CCCCCTGCTCCGAGAAGCTTCCC 0: 1
1: 0
2: 4
3: 56
4: 392
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903782_1018903800 24 Left 1018903782 6:168063814-168063836 CCAGCCCCCTGCTCCGAGAAGCT 0: 1
1: 0
2: 2
3: 19
4: 308
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903792_1018903800 -9 Left 1018903792 6:168063847-168063869 CCCACAGCTGGTGCCAACCTCGG 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903784_1018903800 19 Left 1018903784 6:168063819-168063841 CCCCTGCTCCGAGAAGCTTCCCC 0: 1
1: 0
2: 0
3: 29
4: 229
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903794_1018903800 -10 Left 1018903794 6:168063848-168063870 CCACAGCTGGTGCCAACCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 147
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903790_1018903800 -1 Left 1018903790 6:168063839-168063861 CCCAGACTCCCACAGCTGGTGCC 0: 1
1: 0
2: 1
3: 29
4: 393
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903781_1018903800 29 Left 1018903781 6:168063809-168063831 CCTTGCCAGCCCCCTGCTCCGAG 0: 1
1: 1
2: 4
3: 46
4: 465
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903785_1018903800 18 Left 1018903785 6:168063820-168063842 CCCTGCTCCGAGAAGCTTCCCCA 0: 1
1: 0
2: 3
3: 22
4: 159
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903791_1018903800 -2 Left 1018903791 6:168063840-168063862 CCAGACTCCCACAGCTGGTGCCA 0: 1
1: 0
2: 0
3: 24
4: 282
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274
1018903786_1018903800 17 Left 1018903786 6:168063821-168063843 CCTGCTCCGAGAAGCTTCCCCAG 0: 1
1: 0
2: 3
3: 21
4: 298
Right 1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903800 Original CRISPR CAACCTCGGTGGGCAGGGCC AGG Intronic
900148221 1:1167452-1167474 CAGGCGCTGTGGGCAGGGCCCGG - Intergenic
900285884 1:1900098-1900120 GGAGCTCAGTGGGCAGGGCCTGG + Intergenic
900401088 1:2473247-2473269 CAAGGTCGGGGGGCAGGCCCAGG + Intronic
900619605 1:3580724-3580746 CTACTTGGGAGGGCAGGGCCAGG + Intronic
900625641 1:3607361-3607383 CAGCCTGGCTGGGCAGGGCAAGG - Intronic
900633273 1:3649861-3649883 CGTCCCCGGCGGGCAGGGCCGGG - Intronic
901401013 1:9015071-9015093 CCCCCGGGGTGGGCAGGGCCTGG + Intronic
901492051 1:9601656-9601678 CACCCGCTGTGGGCTGGGCCGGG + Intronic
901791371 1:11655072-11655094 CAAGCTCGGCGGCCTGGGCCTGG - Intronic
902527763 1:17070366-17070388 GAACCCCGGTGGACAGGGCCAGG - Intronic
903008646 1:20315101-20315123 CAACCTAGGGGGCCAGGGGCTGG + Intronic
903013316 1:20345556-20345578 CCACCACGGTGGGCAGGTACCGG - Exonic
903036401 1:20495571-20495593 CAGCCTAGGTGGGGAGGGACAGG + Intergenic
903389713 1:22955214-22955236 CATCCTAGGTTGGCAGAGCCGGG - Intronic
903514166 1:23899256-23899278 CAACTTCTGTGGTCAGGGTCTGG - Intronic
903941948 1:26938091-26938113 CAACCAGGGTGGGGAGGGCTGGG - Intronic
904000350 1:27335337-27335359 GAGCATAGGTGGGCAGGGCCTGG - Intronic
904156552 1:28488200-28488222 AAACCTAGCTGGGCATGGCCAGG + Intronic
904208825 1:28872325-28872347 CAGGCTGTGTGGGCAGGGCCAGG + Intergenic
904295620 1:29517939-29517961 CACCCTGGGTGGACATGGCCTGG - Intergenic
904316811 1:29671040-29671062 CAACCTCAGAGCCCAGGGCCTGG + Intergenic
904355149 1:29933907-29933929 CAACCTCAGAGCCCAGGGCCTGG + Intergenic
905409141 1:37756263-37756285 CAACAGTGGTGGGCAGGGCATGG - Intronic
905798820 1:40830644-40830666 CTACCTCCGTGTGCATGGCCAGG + Intronic
906695485 1:47820555-47820577 CAGCAGCGGTGGGCAGGGCTAGG + Intronic
907381482 1:54094508-54094530 CAACCCAGGAGGGCAGTGCCTGG - Intronic
911963617 1:104337952-104337974 CCACCTCTGGGGGCAGGGCATGG - Intergenic
912442937 1:109712712-109712734 CAGCGTGAGTGGGCAGGGCCCGG - Intronic
915321438 1:155058447-155058469 CAGCCTGGGTGGGCAAGACCAGG + Intronic
915698679 1:157770050-157770072 CAACCTCTGTGGAGAGAGCCGGG + Exonic
920002724 1:202810895-202810917 CATCCTCCGGGGGCGGGGCCCGG + Intergenic
921915994 1:220611164-220611186 CCATCTCTGTGGGCAGGGCATGG - Intronic
922206077 1:223447536-223447558 CCACCTCTGGGGGCAGGGCACGG + Intergenic
923234013 1:232015038-232015060 CAAATTCAGTGGCCAGGGCCAGG - Intronic
923279173 1:232425667-232425689 GAATGTCGTTGGGCAGGGCCTGG + Exonic
1062874026 10:931309-931331 CGGCCGCGGCGGGCAGGGCCGGG - Intronic
1065705660 10:28469501-28469523 CTACCTGGGTGGTCAGGGCTGGG + Intergenic
1066067654 10:31773881-31773903 CAACCACCGTGGGCTGAGCCTGG - Intergenic
1067040671 10:42951734-42951756 CAGCCTGGGTGGGCCTGGCCTGG - Intergenic
1067079105 10:43203597-43203619 CCTCCTAGGTAGGCAGGGCCGGG - Intronic
1067088575 10:43255273-43255295 CAGCCTAGGCGGGCAGGGCTGGG - Intronic
1069641903 10:69961743-69961765 CATGCTCAGTGGGCAGGGCTGGG - Intronic
1070162314 10:73873934-73873956 CACCCGCGGGGGGCGGGGCCGGG + Intronic
1070755999 10:78993694-78993716 CTGCCTCGGTGGGCTGGCCCTGG - Intergenic
1070772061 10:79088328-79088350 AAAACTCCCTGGGCAGGGCCAGG + Intronic
1070966987 10:80535974-80535996 CAACCTGGGTGTGCCTGGCCTGG - Intergenic
1071314555 10:84381635-84381657 CATCCACGGTGGGCCGGGCGCGG + Intronic
1073470148 10:103717193-103717215 CCACCTCGGGGAGCAGAGCCAGG - Intronic
1074264479 10:111887881-111887903 GAAGCTCTGGGGGCAGGGCCTGG - Intergenic
1075077223 10:119359479-119359501 GATCCCAGGTGGGCAGGGCCAGG + Intronic
1076267237 10:129118410-129118432 CACCCAGGGTGGGAAGGGCCTGG + Intergenic
1076662144 10:132062831-132062853 CAACAGCTGTGTGCAGGGCCTGG + Intergenic
1076864388 10:133159992-133160014 CAGCGGCGTTGGGCAGGGCCGGG - Intergenic
1076877228 10:133221863-133221885 AACCCTAGGTGGGCAGGGCTGGG + Intronic
1077034868 11:489762-489784 CACCCCCGGGGGGCAGGGGCCGG + Intronic
1077215072 11:1391865-1391887 CGGCCTCGGTGGGTAGGGGCTGG + Intronic
1077413485 11:2414096-2414118 CAGCCTCGGTGGCCAGGTGCAGG + Exonic
1082997200 11:59263679-59263701 CCACCTCAGTGGGCGAGGCCAGG + Intergenic
1083282912 11:61638467-61638489 CACCCTGGGAGGCCAGGGCCTGG + Intergenic
1083685447 11:64372293-64372315 GAACCTCAGTGGGGAGGGACAGG + Intergenic
1084503959 11:69553704-69553726 GACCCTGGGAGGGCAGGGCCTGG - Intergenic
1084949713 11:72657917-72657939 CAGCCTCTGTGAGCAGGGCAGGG + Intronic
1086382734 11:86274654-86274676 CACCCTAGCTGGGAAGGGCCAGG + Intronic
1089248216 11:117137832-117137854 CAGCCCCGGTGGGCAGGGCAGGG - Intergenic
1089258495 11:117206729-117206751 CAGCCCCGGTGGGCAGGGCAGGG + Exonic
1090226855 11:125076898-125076920 CAACCTCGGTGGCCATGGGAAGG - Intronic
1091219297 11:133920709-133920731 GCCCCTCGGTGGGCAGGGGCGGG + Exonic
1091339499 11:134799347-134799369 CCACGTGGGTGGGCAGGGGCTGG - Intergenic
1091421351 12:343328-343350 CCACCTCTCTGGGCAGGGCATGG + Intronic
1091424584 12:376159-376181 CCACCTCTGGGGGCAGGGCATGG - Intronic
1092527626 12:9318828-9318850 TAGCCTGGGTGAGCAGGGCCTGG - Intergenic
1092539632 12:9412928-9412950 TAGCCTGGGTGAGCAGGGCCTGG + Intergenic
1092772458 12:11909702-11909724 CCACCTCTGGGGGCAGGGCATGG + Intergenic
1095428941 12:42111697-42111719 CCACCTCTGGGGGCAGGGCACGG + Intronic
1096073759 12:48789476-48789498 GACCCTCGGTGGGCGGGGCGGGG - Intergenic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1099720571 12:86356883-86356905 CCACCTCTGGGGGCAGGGCATGG + Intronic
1104960148 12:132484644-132484666 CAGACTCGGGGGCCAGGGCCTGG + Intergenic
1107088479 13:36450586-36450608 CTACTTGGGTGGGCAGGGTCTGG - Intergenic
1113789661 13:113021659-113021681 CCACCAAGGTGGGCAGTGCCAGG - Intronic
1118255366 14:64200865-64200887 CAGACTCTGTGGTCAGGGCCTGG - Intronic
1118320223 14:64748572-64748594 CTCCCACGGTTGGCAGGGCCTGG - Exonic
1118470891 14:66074368-66074390 CAGCCTTGGTGGGCAGAGCCAGG - Intergenic
1121113632 14:91329027-91329049 CATCCTCAGTGGGGAGGGTCTGG + Intronic
1121307684 14:92917290-92917312 CAGCCTCGGTGTCCAGGGCTTGG + Intergenic
1125583271 15:40802612-40802634 GAACCGCGCTGGACAGGGCCAGG + Intronic
1126483612 15:49155282-49155304 CAGACTCGGAGGGCAAGGCCCGG + Intronic
1126890078 15:53195581-53195603 CTACCTCTGTGGGCAGTGACAGG + Intergenic
1127588331 15:60398190-60398212 CTTTCTCGGAGGGCAGGGCCAGG - Intronic
1127873288 15:63090976-63090998 AAACCTGGCTGGGGAGGGCCGGG - Intergenic
1128257968 15:66212302-66212324 CCACCTCTGTGTGCTGGGCCTGG - Intronic
1128736874 15:70058434-70058456 CAACCTTGTTTGGCAGGGACTGG + Intronic
1129688641 15:77700713-77700735 AAACCTGGGTGAGCAGGGGCGGG + Intronic
1130715570 15:86330105-86330127 CAGCCACAGTGGGCAGGGCCAGG - Intronic
1131389385 15:92034591-92034613 CATCCAGGGTGGGCAGGACCAGG + Intronic
1131979329 15:97979941-97979963 CAGCCCCTGTGGGCAGGCCCAGG - Intergenic
1132577850 16:672144-672166 CACCCTCTGTGAGCAGGACCAGG + Exonic
1132697976 16:1210351-1210373 GAACCTGGGTGGGCGGGGGCGGG - Exonic
1132860953 16:2071554-2071576 CATCCTTGTTGGGCAGGCCCAGG - Exonic
1132939082 16:2498170-2498192 ATACCTCGGGGGGCATGGCCTGG + Intronic
1133231945 16:4371079-4371101 CACCGTCGGTGGGTGGGGCCTGG - Intronic
1135115384 16:19718850-19718872 GAAGCTCTGTGGGCGGGGCCTGG - Intronic
1136112853 16:28075701-28075723 CTTCCACGGTGAGCAGGGCCTGG + Intergenic
1136223667 16:28844754-28844776 CAAACTCGGTGAGCAGCTCCCGG + Exonic
1136264383 16:29106432-29106454 CAGCCTCCTTGGGGAGGGCCAGG + Intergenic
1136996529 16:35194700-35194722 CATCCTCGGTGGGCATGGCCTGG - Intergenic
1137250627 16:46737973-46737995 CCACCTTTGTGGGCAGGGGCAGG + Exonic
1137351595 16:47718374-47718396 TGACCTCTGTGGCCAGGGCCGGG + Intergenic
1137710519 16:50563643-50563665 CATCCTCAGTGGGCAAGCCCTGG + Intronic
1138515353 16:57533042-57533064 CAAGCCTGTTGGGCAGGGCCAGG + Intronic
1138533828 16:57649318-57649340 CCATCTCTGTGGGCAGGCCCTGG - Intronic
1141689766 16:85589381-85589403 GATGCTGGGTGGGCAGGGCCTGG + Intergenic
1143512808 17:7405434-7405456 CAGCCCCGGGGGGCGGGGCCGGG - Intronic
1144813513 17:18017479-18017501 CAGCCTTGGTGGGCAGGCCCAGG - Intronic
1144950346 17:18990508-18990530 CTGCCACGGTAGGCAGGGCCTGG - Intronic
1149522803 17:57330883-57330905 AAACCTCTTTGGGCAAGGCCAGG - Intronic
1149992581 17:61391190-61391212 CAACATGGATGTGCAGGGCCAGG + Intronic
1149993831 17:61396902-61396924 CCTCCTCTGTGTGCAGGGCCGGG - Intergenic
1151494317 17:74450320-74450342 CAACATCTCTGGTCAGGGCCTGG + Intronic
1151629439 17:75300631-75300653 CACCCTCGGGAGGCAGGGGCAGG - Intergenic
1152197023 17:78924314-78924336 CAAACTGGCTGGGCAGGGACCGG - Intronic
1152238571 17:79150629-79150651 CCACCTCTGGGGGCAAGGCCAGG + Intronic
1152436580 17:80279978-80280000 CCATCTCGATGGGCAGGGGCTGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152565258 17:81097487-81097509 CAGCGTGGGTGGGCAGTGCCGGG - Intronic
1152568499 17:81111035-81111057 CAGCCTGGGTGGGGAGGGCCCGG + Intronic
1152643575 17:81458962-81458984 CGCCCTAGGTGAGCAGGGCCAGG + Exonic
1152745296 17:82036058-82036080 CTACCTCTGTGGGCAGGGCGGGG + Exonic
1153530617 18:6042092-6042114 CATCCTCTGTGGGGAGGGCTTGG - Intronic
1153782789 18:8509242-8509264 CAAGGTGTGTGGGCAGGGCCAGG - Intergenic
1154133128 18:11752645-11752667 CAGGCTGGGCGGGCAGGGCCGGG + Intronic
1154192061 18:12238101-12238123 CAAGCATGGTGGCCAGGGCCTGG + Intergenic
1155143716 18:23066366-23066388 CAACCTGGAAAGGCAGGGCCAGG + Intergenic
1160793251 19:932647-932669 CCTCCGGGGTGGGCAGGGCCAGG - Exonic
1160837020 19:1129609-1129631 CAGCCTGGGTGGGCAGTGTCCGG - Intronic
1160908174 19:1461560-1461582 CAACCTCACTGGGCCGGGCGCGG + Intronic
1161273832 19:3404604-3404626 CCACCCAGGAGGGCAGGGCCGGG + Intronic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1162566372 19:11447435-11447457 GAAGGTCGGTGGGCAGTGCCTGG - Exonic
1162893903 19:13753198-13753220 CAGCCTCAGGGGGCAGGACCTGG - Intronic
1163255528 19:16153666-16153688 GAAGCTCGGTGGGCGTGGCCTGG + Intronic
1163380271 19:16961570-16961592 CCACCTCTGTGAGCAGGGCATGG + Intronic
1163591523 19:18196758-18196780 AAACCAGGGTGGGCAGGACCCGG + Intronic
1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG + Intronic
1166275857 19:41753394-41753416 CCACCTCGGTGGGTGGCGCCGGG + Intronic
1167016144 19:46842327-46842349 CAACCACAGTAGGCAGGGCTGGG - Intronic
1167507384 19:49878035-49878057 CACCCTCAGGGGGCGGGGCCGGG - Intronic
925265162 2:2561871-2561893 GAAGCTCTGGGGGCAGGGCCGGG + Intergenic
927682907 2:25151865-25151887 TCACCTCAGTGAGCAGGGCCTGG + Intronic
928904800 2:36356924-36356946 CCACCTCGGGGAGCAAGGCCGGG - Intronic
929765558 2:44841076-44841098 TACCCTCGGTGGTGAGGGCCAGG + Intergenic
932190998 2:69741755-69741777 CACCCTCGGAGGGCCGAGCCCGG - Intronic
932343076 2:70978870-70978892 CCTCCCTGGTGGGCAGGGCCTGG + Intronic
932714716 2:74092925-74092947 CGACTTCGGTGGCCAGGTCCTGG - Exonic
932895894 2:75639253-75639275 CATCTTGGGTGGGCAGTGCCAGG + Intergenic
933750539 2:85600056-85600078 CAGGCTCGCTGGGCAGGGCCAGG - Intronic
934562672 2:95321074-95321096 AAGGCTCGGGGGGCAGGGCCAGG - Intronic
934640495 2:96024682-96024704 CACCCTGGGTGGGCAGAGCAGGG + Intronic
936104766 2:109614570-109614592 CCAGCTCGGCGTGCAGGGCCCGG - Exonic
936252437 2:110877015-110877037 CAACCTCCCTGGGCTGTGCCTGG + Intronic
937083432 2:119156433-119156455 CTACCTCCCTGGCCAGGGCCCGG + Exonic
938068602 2:128294805-128294827 CAGCCTGGGTGGGCAGGCCCTGG + Intronic
938392459 2:130916388-130916410 GACCCTCGGTGGTCGGGGCCGGG - Intronic
942228140 2:173834810-173834832 CAGCCTCTCAGGGCAGGGCCGGG - Intergenic
943872056 2:193012111-193012133 CAGCCTGGGAGGGCTGGGCCAGG - Intergenic
944581817 2:201138264-201138286 CTACCTGGGTGAGCAGGTCCAGG + Intronic
946335324 2:219031745-219031767 CAACCGCTGAGGGGAGGGCCAGG + Intronic
948025909 2:234776009-234776031 CCACCTCTGAGGGCAGGGCATGG + Intergenic
948258934 2:236588935-236588957 GAACCTCGGAGGGCAAGCCCCGG + Intergenic
948804516 2:240447699-240447721 CAGCGACTGTGGGCAGGGCCAGG - Intronic
1169706690 20:8514146-8514168 CAGCCTGGGTGGGCCGGGCATGG + Intronic
1173230496 20:41192372-41192394 CAACCAAGGTGGGCAGGTGCAGG + Intronic
1173543822 20:43876716-43876738 CCACCTCTGGGGGCAGGGCATGG - Intergenic
1175199013 20:57265690-57265712 CAACCTCGGTGAGTAAGGGCAGG - Exonic
1175445918 20:59019197-59019219 CCACCTCGGGGCACAGGGCCTGG - Intergenic
1175661108 20:60813257-60813279 CAGTCGAGGTGGGCAGGGCCAGG - Intergenic
1176151852 20:63595549-63595571 CACCCTCTGTGGCCATGGCCAGG + Intronic
1176380922 21:6111661-6111683 CGACCTCGGGTGGCAGGGCCAGG + Intronic
1179742550 21:43426579-43426601 CGACCTCGGGTGGCAGGGCCAGG - Intronic
1180117949 21:45724492-45724514 CCACCTCGCTTGGCAGGGGCAGG - Intronic
1181312942 22:21955306-21955328 CTGGCTAGGTGGGCAGGGCCAGG + Intergenic
1181346050 22:22221378-22221400 CTGGCTAGGTGGGCAGGGCCAGG + Intergenic
1181493806 22:23276756-23276778 CAAACCCGTTGGGCAGTGCCAGG - Intronic
1181677086 22:24462420-24462442 GAATCTAGGTGGGGAGGGCCAGG + Intergenic
1182575628 22:31271026-31271048 GAAGCTGGGTGGGCATGGCCTGG + Intronic
1183831441 22:40420347-40420369 CAGCCCCTGTGGGAAGGGCCAGG + Intronic
1184225659 22:43127763-43127785 CCACCTCGGAGAGCTGGGCCAGG - Exonic
1184231416 22:43160177-43160199 GACCCTGGCTGGGCAGGGCCTGG - Intronic
1184667597 22:45996960-45996982 CCACGTGGGTAGGCAGGGCCTGG + Intergenic
1184723752 22:46331209-46331231 CAAGCTCAGTGGGCAGTGGCAGG + Intronic
1184738082 22:46410802-46410824 CAGCCTGGGTGGGCGGGGCTTGG - Intronic
1185067752 22:48640531-48640553 CCAGCTGGGTGGGCAGGGCAGGG + Intronic
1185245219 22:49769728-49769750 CAACCTGGGTGCTCAGAGCCTGG + Intergenic
950391356 3:12699254-12699276 GAACCTCTGTGGGTAGGGACTGG + Intergenic
952888977 3:38028889-38028911 CCTCCTCGGGGGACAGGGCCAGG - Intronic
953024806 3:39138633-39138655 CAGCCTTGGTGGGGAGGGCCTGG + Intronic
954110428 3:48430043-48430065 CAGGGGCGGTGGGCAGGGCCAGG - Intronic
954618885 3:51984518-51984540 CAAGCTTGGTGGCTAGGGCCTGG + Intronic
959045328 3:101467237-101467259 CCACCTCTGCGGGCAGGGCATGG + Intronic
961491646 3:127260618-127260640 CCCCCTGGGTGGGCAGGGCCTGG + Intergenic
961742382 3:129040814-129040836 GAACCTTGGTGGGGAGGGGCAGG + Intergenic
962745794 3:138396550-138396572 CAAGCTCGGTAGGCAGGGTGGGG - Intronic
963052233 3:141152065-141152087 GGACCTCTGTGGGTAGGGCCGGG + Intergenic
968486885 4:867157-867179 CCACCTCGGAGTGCAGGCCCAGG + Exonic
968834692 4:2954936-2954958 CCACCTCCCTGGGCAGGGCCTGG + Intronic
969260584 4:6030844-6030866 GAAGCTCTGTGGGCAGGGCCTGG - Intronic
969344055 4:6560232-6560254 GAGCCTGGGTGGGCTGGGCCTGG - Intronic
969686845 4:8680336-8680358 CAACCTCGTGGGGAAGAGCCAGG + Intergenic
969721826 4:8896284-8896306 CCAGCTCAGTGGGCAGGTCCAGG + Intergenic
970672471 4:18412644-18412666 CAACGTCGGGGGTCAGGGTCTGG - Intergenic
971245005 4:24919497-24919519 CAACCTTGGCGGGCAGGGGGTGG + Intronic
977536517 4:98261224-98261246 CATGCTCGGTGGGGAGGGCGGGG + Intergenic
978641471 4:110876254-110876276 CCACCTCTGGGGGCAGGGCACGG - Intergenic
979674693 4:123398409-123398431 CAACCGCGGCGGGGAGGGCGAGG - Intronic
982493749 4:156063974-156063996 CAGCCTCAGTGGGCACAGCCTGG - Intergenic
984767229 4:183408931-183408953 CAGCCATGGAGGGCAGGGCCAGG + Intergenic
987077737 5:14399816-14399838 CAGGGTCGCTGGGCAGGGCCAGG + Intronic
991573502 5:68079506-68079528 AAAACTTGGTGGGCAGGGCAGGG + Intergenic
995492475 5:112707609-112707631 CAACCTCGGTCCGCAGCTCCCGG - Intronic
996356087 5:122598106-122598128 CCACCTCTGGGGGCAGGGCATGG - Intergenic
997305162 5:132830935-132830957 CTCCCTCGGTGGGGAGGTCCAGG + Intergenic
997736111 5:136213707-136213729 CAACCCTGGTGGGCTGGCCCAGG - Intronic
997861645 5:137423363-137423385 CCACCTCTGGGGGCAGGGCATGG - Intronic
999693740 5:154170437-154170459 CAACTGCGGTGGGATGGGCCTGG + Intronic
1003045347 6:2728604-2728626 CAACCTCTCTGGGCATGGCTGGG - Intronic
1003045442 6:2729255-2729277 CAACCTCTCTGGGCATGGCTGGG + Intronic
1006589211 6:35141681-35141703 GAACCCCAGTGGGCAGAGCCTGG - Intronic
1006932257 6:37695506-37695528 CCAGCTAGCTGGGCAGGGCCAGG + Intronic
1007054500 6:38868966-38868988 CAACCTGGCTGGGCTGGGCTGGG - Intronic
1008037796 6:46764449-46764471 CAACCTCGATCGGCCGGGCGCGG + Intergenic
1009499231 6:64390306-64390328 CCACCTCTGGGGGCAGGGCACGG + Intronic
1010079974 6:71849679-71849701 AATCCTCTGTGGACAGGGCCTGG - Intergenic
1017146700 6:151240993-151241015 CAGCCGCCGTGGGCAGGGCGCGG - Intronic
1017697973 6:157037841-157037863 CAACCGCAGTGTGCAGGGTCTGG + Intronic
1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG + Intronic
1019121842 6:169810445-169810467 TGGCCTCGGTGGGCAGGGCTTGG + Intergenic
1019283934 7:214914-214936 CAAACTCGGAGTGCCGGGCCTGG + Intronic
1019502051 7:1369385-1369407 GGTCCGCGGTGGGCAGGGCCTGG - Intergenic
1019643405 7:2116508-2116530 GACCCCAGGTGGGCAGGGCCTGG + Intronic
1021373837 7:19883227-19883249 CCACCTCTGGGGGCAGGGCACGG - Intergenic
1021954702 7:25812753-25812775 AAACCTCGCTAGGCAGGGCCAGG + Intergenic
1024924647 7:54600052-54600074 CAAACTCTATCGGCAGGGCCTGG + Intergenic
1024959969 7:54963811-54963833 CACCCACAGTGGGCAGGGCAAGG - Intergenic
1030293098 7:107891437-107891459 CCACCTCGGAGCCCAGGGCCGGG - Intronic
1031073546 7:117190179-117190201 CAGCTTGGGAGGGCAGGGCCAGG + Intronic
1033097080 7:138441477-138441499 CCACCTGGGTGAGCAGGTCCAGG - Intergenic
1033207840 7:139437925-139437947 CAAACTCAGTGGGCAGGGGTGGG - Intergenic
1035020307 7:155796912-155796934 CAGCCTCGGGGGGCTGGGGCCGG - Intergenic
1035176331 7:157054695-157054717 CATCCTCTGTTGGCAGGGTCTGG - Intergenic
1035470178 7:159104565-159104587 CACCATCGGTGGTGAGGGCCTGG - Intronic
1035470219 7:159104702-159104724 CACCGTCGGTGGTGAGGGCCTGG - Intronic
1035745350 8:1958686-1958708 CAACCTCGGGGGGCTGGGTGGGG + Intergenic
1035757134 8:2042977-2042999 CATCCCGGGTGGGCAGGGGCAGG + Intergenic
1035911581 8:3572268-3572290 CAAACTCTGAGGGCAGAGCCTGG + Intronic
1037806198 8:22059029-22059051 CATCCTGGGTGGGGAGGGGCAGG - Intronic
1037999478 8:23379515-23379537 CCACCTCTGGGGGCAGGGCATGG - Intronic
1038266278 8:26041865-26041887 CAGGCTCGGTGCGCAGAGCCGGG + Intronic
1039146319 8:34451318-34451340 CCACCTCTGGGGGCAGGGCATGG - Intergenic
1039531819 8:38269237-38269259 CCACCTCCGCGGGGAGGGCCGGG + Intronic
1039554338 8:38466228-38466250 CAAGCCCGGTGCGCAGGGCCGGG - Intronic
1047053460 8:121138722-121138744 CAACCTCTGAGGCCACGGCCTGG - Intergenic
1049106430 8:140616667-140616689 CAGCAGCAGTGGGCAGGGCCTGG + Intronic
1049229122 8:141473022-141473044 CAAAGCCGGTGGGCGGGGCCTGG - Intergenic
1049258931 8:141628417-141628439 CAATCTCTGTGGGCTTGGCCTGG + Intergenic
1049340718 8:142111160-142111182 CACCCTCTGTGGGCAGAGTCTGG - Intergenic
1049386126 8:142343987-142344009 AGCCCTCGGAGGGCAGGGCCTGG + Exonic
1049435750 8:142585527-142585549 CGGCCTGGGTGGGCAGGGACGGG - Intergenic
1049587234 8:143437736-143437758 AAACCTGGGTGGGGAGGGCTGGG + Exonic
1049641408 8:143717631-143717653 CAATCTGGGTGGGCAGGGGATGG + Intronic
1049961932 9:745203-745225 GAACCTCGGTGGGTGGGGCCAGG - Exonic
1052941353 9:34133900-34133922 CCACCTGGGTGAGCAGGTCCAGG + Intergenic
1052991612 9:34522125-34522147 CAAGCTTGGTGGGCAGGACCAGG - Intronic
1053157944 9:35792990-35793012 CAACCTCAGTGTGCAGCACCAGG + Exonic
1056842223 9:90007577-90007599 CTGCCTCTGCGGGCAGGGCCAGG + Intergenic
1057266492 9:93621220-93621242 CAACCCTGGTGGGCGGGCCCTGG + Intronic
1058530725 9:105902519-105902541 GAGCCTTGGTGGGCAGTGCCTGG + Intergenic
1060828767 9:126701042-126701064 TCTCCTTGGTGGGCAGGGCCCGG + Intergenic
1060989251 9:127838805-127838827 CAGCCCCGCTGGGCAGGGGCTGG - Intronic
1061127884 9:128688648-128688670 CAAGCTTGCTGGGCAGGGCTTGG + Intronic
1061417292 9:130454033-130454055 CAGCCTGTGTGGCCAGGGCCAGG + Intronic
1061618685 9:131796705-131796727 CAGCCTCGGTGGGGTGGCCCTGG - Intergenic
1062011161 9:134267566-134267588 CAACCCCCCTGGGCCGGGCCGGG - Intergenic
1187230260 X:17415021-17415043 CAACCTCCCGGGGCAGGGCAGGG - Intronic
1187447811 X:19373654-19373676 CTCCCTGTGTGGGCAGGGCCAGG + Exonic
1187658538 X:21510623-21510645 CAACATAAGTGGGCAGGTCCTGG - Intronic
1189821397 X:44873021-44873043 CGGCCTCGGTGGGCGGGGCTCGG + Intergenic
1190533930 X:51407707-51407729 CAGCCTCGGATGACAGGGCCTGG - Exonic
1190533950 X:51407806-51407828 CGGCCTCGGCGGGCAGGGCCTGG - Exonic
1190533959 X:51407839-51407861 CAGCCTCGGCGGGCAGGGCCTGG - Exonic
1190533967 X:51407872-51407894 CGGCCTCGGCGGGCAGGGCCTGG - Exonic
1190533984 X:51407938-51407960 CGGCCTCGGCGGGCAGAGCCTGG - Exonic
1190931142 X:54950614-54950636 CGAGCTGTGTGGGCAGGGCCGGG + Intronic
1191070349 X:56394314-56394336 CCACCTCTGGGGGCAGGGCATGG - Intergenic
1191192301 X:57679638-57679660 CACCGTGTGTGGGCAGGGCCCGG + Intergenic
1193082036 X:77415651-77415673 AGACCTCTTTGGGCAGGGCCTGG - Intergenic
1195527956 X:105914973-105914995 CAACATTGGTAGACAGGGCCAGG - Intronic
1200072460 X:153535915-153535937 CACCCATGGTGGGCAGGACCCGG + Intronic
1200161957 X:154014114-154014136 CAGCTCAGGTGGGCAGGGCCCGG + Exonic
1201415591 Y:13746175-13746197 CCACCTCTGGGGGCAGGGCACGG - Intergenic
1201450136 Y:14102682-14102704 CCACCTCTGGGGGCAGGGCATGG + Intergenic