ID: 1018904000

View in Genome Browser
Species Human (GRCh38)
Location 6:168064702-168064724
Sequence CCTTCTGTCCTGAAGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018904000 Original CRISPR CCTTCTGTCCTGAAGGCCCA AGG (reversed) Intronic
900012806 1:131377-131399 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
900042870 1:487364-487386 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
900064307 1:722361-722383 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
900160205 1:1219711-1219733 GTTTCTGTCCTGGAGACCCAGGG - Intronic
900395113 1:2450291-2450313 CCGCCTGTGCTGGAGGCCCACGG - Intronic
900566377 1:3334200-3334222 CCCTCTTTCCTGAAAGCTCAAGG - Intronic
901290547 1:8120785-8120807 CATCCTGTCCTGGAGGCACATGG + Intergenic
901849651 1:12007368-12007390 CCTGCACACCTGAAGGCCCAGGG - Intronic
902894807 1:19472037-19472059 CCCTGTGTGCTGATGGCCCATGG - Intronic
903175444 1:21577636-21577658 CGTCCTGTTCTGAGGGCCCAGGG + Exonic
903273195 1:22204916-22204938 CCTTCTCCCCCGAAGACCCAGGG + Intergenic
903569895 1:24296666-24296688 CCTACCGTCCAGAAAGCCCAGGG + Intergenic
904442593 1:30541334-30541356 CCTTGCTTCTTGAAGGCCCAGGG - Intergenic
905324958 1:37145385-37145407 TCTTCCTTCCTGAAAGCCCAGGG + Intergenic
906034206 1:42740594-42740616 CCTTCTGTCCTAAAGTCAAAGGG - Intergenic
907122986 1:52024025-52024047 CCTTCTGTCATTCAGGCTCAAGG + Intronic
907946305 1:59139569-59139591 GCTTGTGTCCTGAAGCCCCAGGG + Intergenic
908667531 1:66509834-66509856 CCAGCTGTCCTGAAGCCCAAAGG + Intergenic
909503772 1:76364190-76364212 CTTTATCTCCTGAAGGACCAAGG + Intronic
909950073 1:81708569-81708591 CCTTCTCTTCTGAAGTGCCAAGG - Intronic
912036603 1:105324566-105324588 CATTTTTTCCTTAAGGCCCAAGG + Intergenic
912258319 1:108083743-108083765 TCTTCTTTCCTAAAGGCACAGGG - Intergenic
916017082 1:160759735-160759757 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
917495209 1:175534248-175534270 CCTTGTGTCCTGAATTCACATGG + Intronic
920880607 1:209876986-209877008 CCTTATTTCCTGAAACCCCAAGG + Intergenic
922099207 1:222468373-222468395 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
922161931 1:223084496-223084518 CCTTCTTTCCTGAGGGCCTAAGG - Intergenic
922261244 1:223947867-223947889 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
922462520 1:225824271-225824293 CCTTCTGGCCTGAAGACTCAAGG + Intronic
922735828 1:227977873-227977895 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
923981431 1:239328373-239328395 CCTGCTGTCCTCAAGGGCCAAGG + Intergenic
924342411 1:243050047-243050069 CCATCTGCCCTGAAAGCCCAGGG + Intergenic
924396933 1:243630566-243630588 ATTTCTGTCCTCTAGGCCCATGG + Intronic
1063364050 10:5479085-5479107 CCTTCTCTCCTGGAGGCCCCTGG + Intergenic
1064074391 10:12257302-12257324 CCTTCTGTCCTGATGACACTGGG + Intergenic
1065423281 10:25571306-25571328 CCCTCTGTCCTGAAGGACAGTGG + Intronic
1065788684 10:29240115-29240137 CCTTCTTTCCTGCGGGTCCAGGG - Intergenic
1066217011 10:33297775-33297797 CCCTCTGTCCTGACGGCAGAGGG + Intronic
1066734066 10:38455508-38455530 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1067051873 10:43026264-43026286 CCTTCTGCTCAGAGGGCCCAGGG + Intergenic
1067509967 10:46886379-46886401 CCTTCTGTCCTTACCACCCAAGG - Intergenic
1067652286 10:48165479-48165501 CCTTCTGTCCTTACCACCCAAGG + Intronic
1067741401 10:48898361-48898383 CCAGCTGCCCTGGAGGCCCAGGG - Intronic
1068446145 10:57126168-57126190 TCTTTTATCCTGAAGGCCTAAGG + Intergenic
1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG + Intergenic
1069514418 10:69066223-69066245 TCTTGTGTCTTTAAGGCCCAAGG + Intergenic
1071235864 10:83647337-83647359 CCTGCTGTGCTGGAGGGCCAGGG - Intergenic
1072827323 10:98620554-98620576 CCTTCCCTCCTGAAAGCCCCTGG + Intronic
1074421026 10:113309128-113309150 CCTTCATCCCTGCAGGCCCAGGG - Intergenic
1074853451 10:117456735-117456757 CCTTCTGGTCAGAAGGCTCAAGG - Intergenic
1075092063 10:119449352-119449374 CCTTCTGTCCCAGAGGACCAGGG - Intronic
1075824589 10:125344530-125344552 CCTGCTGTCCTAAAGTCCCTTGG + Intergenic
1076159785 10:128234897-128234919 CCATCTGGCCTCCAGGCCCAGGG - Intergenic
1076267813 10:129122805-129122827 CCTTCGGTCCTTAAGCCACAGGG - Intergenic
1076402693 10:130194205-130194227 CCTGCTGCCCTGCAGGCCCCTGG + Intergenic
1076804400 10:132847803-132847825 CCTTGTGTCCCGAAAACCCAGGG - Intronic
1076853274 10:133103392-133103414 CCTCCTGGCCTGAAGGGCCCAGG - Intronic
1076969142 11:123581-123603 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1077192293 11:1260509-1260531 CCCTCGGTCCTGGAGGGCCATGG + Intronic
1077409550 11:2397113-2397135 CCTTCTGCCCTGGGGTCCCAGGG + Exonic
1077555835 11:3225621-3225643 CCTAATGTCCTGAGGGCTCAAGG + Intergenic
1078541140 11:12213949-12213971 CCTCCTATCCTCTAGGCCCATGG - Intronic
1078729624 11:13963268-13963290 CCTTCTGTCCTGGCTGCCCTCGG + Intronic
1078820662 11:14877768-14877790 CCTTCTGTCCTGGGGGGCCTTGG - Exonic
1079207524 11:18429454-18429476 CCCTGTGTTATGAAGGCCCAAGG - Intronic
1081609328 11:44549774-44549796 CCTTCATTCCTGAAGGGCCTGGG - Intergenic
1083202888 11:61131088-61131110 CCCTCTGGCCAGAGGGCCCAAGG + Exonic
1084051133 11:66600705-66600727 CTTTCTGTGATCAAGGCCCAGGG + Intronic
1087459222 11:98424126-98424148 CCATCTGTCCTGATTGCCCCTGG - Intergenic
1088157801 11:106829883-106829905 CCTTCAGTCCTGAAGGATCTGGG - Intronic
1088357836 11:108961709-108961731 CCTTCTGCCCTGTGTGCCCACGG - Intergenic
1088727535 11:112652865-112652887 GCTGCTGGCCTGAAGGCCCATGG - Intergenic
1089137059 11:116257971-116257993 CCTTCTGGCAAGAAAGCCCAGGG - Intergenic
1089381418 11:118035538-118035560 CCTTCTGTTCTGATGGCACCTGG - Intergenic
1090640897 11:128728076-128728098 GCTACTCTGCTGAAGGCCCAAGG - Intronic
1091023065 11:132118613-132118635 ACTTCTGTCCTCAAGAGCCACGG + Intronic
1091406081 12:210410-210432 CCTTCTGACCTGGAGGCCAGAGG - Exonic
1092283248 12:7113484-7113506 CCTTCTGTCCTGAAAGGGGAAGG + Intergenic
1092896826 12:13020165-13020187 CCTTCTTACATGATGGCCCAGGG - Intergenic
1092963815 12:13622370-13622392 CATTCTGTCCTGCAGCCCCGGGG + Intronic
1097246623 12:57610968-57610990 CCTTCTTTCCTCCAGGCCCCGGG - Intronic
1098736363 12:74110882-74110904 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
1099904870 12:88760271-88760293 CCTCCTCTCCTGAAGACCTATGG - Intergenic
1100950008 12:99837234-99837256 CATTCTTTCCTGAAGGCTCTAGG - Intronic
1102386794 12:112516752-112516774 CCTTATATCCTTAAGACCCAAGG - Intergenic
1103539609 12:121656819-121656841 CCTTCTGTCCTGAATTCTCTAGG + Intronic
1103704830 12:122865854-122865876 CCATGTGTGCTGAAGGCCCAGGG - Exonic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104074969 12:125380864-125380886 CCTTCTGTCCTTCTGGCCTAGGG + Intronic
1105280327 13:18959409-18959431 CCCTCAGGCCTCAAGGCCCAGGG - Intergenic
1107036130 13:35904633-35904655 CCTTCTTTCCTAAAGGCAAAAGG - Intronic
1107714404 13:43185412-43185434 CCTCCAATCCTGAAAGCCCAGGG + Intergenic
1109133535 13:58618673-58618695 CCTTCTGTCTTGAAGTCTCAAGG - Intergenic
1110032828 13:70638782-70638804 GCTTCTGTCATGCAGGGCCAGGG - Intergenic
1113251722 13:108460745-108460767 CCATCTGTCCTAAATGCCCCTGG + Intergenic
1113770407 13:112904568-112904590 CCCTGAGTCCTGGAGGCCCAGGG + Intronic
1114628906 14:24147093-24147115 CGGTCTGTCCTGAAGGCAGAGGG - Exonic
1114812255 14:25914629-25914651 CCCTCACTCCTTAAGGCCCAGGG + Intergenic
1121023186 14:90594314-90594336 CCTGCTGTCCTGAAAGGCTAAGG + Intronic
1122738136 14:103855505-103855527 CCTTCTGCCCTGACGGTCAAGGG + Intergenic
1124058950 15:26269746-26269768 CCTGCAGTCCTGCAGACCCAAGG + Intergenic
1124712739 15:32029511-32029533 CCTTCTTTCCTGCAGCCCCCGGG - Intergenic
1129963265 15:79709501-79709523 CTCTCTCTCCTGACGGCCCATGG + Intergenic
1130763962 15:86851451-86851473 CCTCCTGTTCTCAATGCCCAGGG - Intronic
1131172806 15:90190548-90190570 CCTTCCTTCCCAAAGGCCCAAGG - Intronic
1131753421 15:95534692-95534714 CCTTTTGGACTGAAGCCCCATGG - Intergenic
1133708420 16:8377924-8377946 ACTTCAGTCCTTAAGCCCCAGGG - Intergenic
1134630214 16:15750760-15750782 CCTTCTGTGCTCCAGGCCCTGGG + Intronic
1134812220 16:17177351-17177373 CCTTCTCTTCTAAAGGACCAGGG - Intronic
1134866009 16:17607784-17607806 GCTCCTGGCCTGAAGCCCCAAGG + Intergenic
1137652423 16:50131928-50131950 CCTTCATTCCTGAAGGACCTGGG + Intergenic
1138089915 16:54165545-54165567 CCTTCTGTCCTTCAGCCCCGCGG - Intergenic
1138381768 16:56607710-56607732 CCTTCTGACCCTCAGGCCCAAGG + Intergenic
1138382332 16:56611282-56611304 CCTTCTGACCCTCAGGCCCAAGG + Intergenic
1139340503 16:66265022-66265044 CCTTCTCCCCTGGAGTCCCATGG - Intergenic
1140826070 16:78707990-78708012 TCTTCTGACCTGAAATCCCATGG + Intronic
1141166089 16:81661882-81661904 CCTTCTGGTCTGAGTGCCCAGGG + Intronic
1141277861 16:82604437-82604459 GCTTCTGTTCTGAGGGTCCATGG + Intergenic
1141433111 16:83981092-83981114 CACTCTGTCCTGAAGGCCATGGG + Exonic
1142451532 16:90175541-90175563 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1142871162 17:2821956-2821978 CCTTCTGGCCTGGGGGTCCAGGG - Intronic
1144208094 17:12993333-12993355 CCTTCATTCCGGAAGGCCAAGGG + Intronic
1146286776 17:31579386-31579408 CTTTCTGGCCTGAGGGCACAGGG - Intergenic
1146531045 17:33607982-33608004 CCTCTTGTCCTGACAGCCCATGG - Intronic
1146655068 17:34630188-34630210 TCTACTCTCCTGAAGGCCTAGGG - Intronic
1147061531 17:37883432-37883454 CCTTCTGTCATGGAGGCTAATGG + Intergenic
1147124553 17:38357215-38357237 CCTTTAGACCTGAAGACCCAAGG - Intronic
1148753874 17:49962478-49962500 CCTTCTCCCCTAAAGGCCCTGGG + Intergenic
1150660358 17:67070378-67070400 CCTTCTGCCCTTAAGGTCAAAGG - Intergenic
1151976590 17:77487111-77487133 CCTCCTGTCCAGAAAGCACAAGG + Intronic
1152726325 17:81948510-81948532 CATGCTGTCCTGCAGGACCAGGG - Intergenic
1152844423 17:82591123-82591145 CCTGCTGTCCTGCAAGGCCAGGG - Intronic
1154170372 18:12046854-12046876 CTCCCTGTCCTGCAGGCCCAGGG + Intergenic
1154228278 18:12528510-12528532 CCTTCATTCCTGAATGTCCAGGG - Intronic
1156481229 18:37437565-37437587 TCTTGTGTCCTGGAGGACCAAGG + Intronic
1156582647 18:38395145-38395167 CCTTCATTCCTGAAGGGCCTGGG - Intergenic
1160449214 18:78950646-78950668 CGTGCTCTCCTGAAGGCTCAGGG - Intergenic
1160645948 19:193507-193529 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1160762377 19:791987-792009 CCTGTTGGCCTGAGGGCCCAGGG + Intergenic
1161296398 19:3522687-3522709 CTTTCTGCCCTGGAGGCCCCAGG - Intronic
1163389522 19:17021906-17021928 CCTTCTGCCCTAAATCCCCAGGG - Intronic
1163497048 19:17652670-17652692 CTGTCTGTCCTGCAGGCCCGGGG - Exonic
1163514697 19:17755820-17755842 CCTTCAGCCCTGCAGGACCAGGG + Intronic
1164250472 19:23470844-23470866 CCTTCTTTCCTGGGCGCCCAAGG - Intergenic
1164813861 19:31179219-31179241 CCTTGTGACCTGAAGGGCCAGGG + Intergenic
1165434621 19:35789213-35789235 CCTTCTCTCCTGCAGGCACCCGG - Intergenic
1165849661 19:38842271-38842293 CCTATTGTCTTGGAGGCCCATGG + Intronic
1166538581 19:43591498-43591520 CCTTCTGTCCTGAAGGGAGTTGG - Exonic
925070665 2:964913-964935 CCCTCTGTCCTGTTGGCCCTGGG + Intronic
928169508 2:28994344-28994366 CCAGCTGCCCTGAAAGCCCATGG - Intronic
928317133 2:30255218-30255240 CCTTGTGTCCTCACAGCCCATGG + Intronic
928973537 2:37058534-37058556 CCATCTGTAATGAAAGCCCATGG - Exonic
929183214 2:39066083-39066105 CCTTCTACCCTGAAGGCTGAGGG - Intronic
932360811 2:71104103-71104125 CCTTCCTTCCTGAAGTCCCAAGG - Intergenic
934951722 2:98580285-98580307 GCTTTTCTCCTGGAGGCCCAGGG + Intronic
935410784 2:102759748-102759770 CATTCCTTCCTGAAGGCTCAAGG + Intronic
936044258 2:109174098-109174120 CCTGCTGTCCTGAAGCCACTGGG - Intronic
937983542 2:127628506-127628528 CTTCCTGTCCTGCAGGGCCATGG - Exonic
943458979 2:188146084-188146106 CATTCTTTCCTGAAGGCCCTAGG + Intergenic
943487649 2:188507063-188507085 CATTCTTTCCTGAAGGCTCCTGG + Intronic
944353086 2:198753482-198753504 CCTTCTGTAGTCAAAGCCCATGG + Intergenic
945041381 2:205746180-205746202 CCCTCTGGCCTGAAGAGCCAGGG - Intronic
946370731 2:219279783-219279805 CCTTCTCTTCTGCAGCCCCAAGG + Exonic
946413213 2:219526024-219526046 TCTTATCTCCTGGAGGCCCAGGG + Intronic
948055115 2:235005250-235005272 CCTGCTGTGCTGTTGGCCCAGGG + Intronic
948272567 2:236686013-236686035 TCTCCTGTCCTGAGGGCTCAAGG - Intergenic
948278154 2:236725828-236725850 CCTTCTGTCCACAAGGGTCACGG - Intergenic
948643950 2:239392309-239392331 CCTTCTGACCTGGAGAGCCAAGG + Intronic
1169147006 20:3259330-3259352 CCTGATGGCGTGAAGGCCCAGGG + Intronic
1169182704 20:3583927-3583949 CATGCTGTCCTCAAGGCACATGG - Exonic
1170495007 20:16915543-16915565 CCTTCAGGTCTGAAGGCCAAGGG + Intergenic
1171130845 20:22651885-22651907 GCTTCTTCCCTGAAGGCTCAGGG + Intergenic
1171183365 20:23107492-23107514 CCTTCCTTCCTGCAGCCCCATGG - Intergenic
1171804600 20:29663568-29663590 TCTGCTGTCCTGAATGACCATGG - Intergenic
1172967146 20:38844984-38845006 CCTTGTCTCCTTCAGGCCCAGGG - Intronic
1173307949 20:41869230-41869252 CCTTCTTTGCTGATGGCTCAAGG + Intergenic
1173809069 20:45945448-45945470 CCTTCTTGCCTGACAGCCCAAGG + Intronic
1173875101 20:46365304-46365326 CCTTCTGTTCAGAGGGGCCAGGG - Intergenic
1174087250 20:48018180-48018202 CCTCCTGTCCAGAAGGCCCTTGG + Intergenic
1174129033 20:48328788-48328810 CCTCCTATCCAGAAGGCCCTTGG - Intergenic
1174182890 20:48686226-48686248 CCTTCTACCCTGGAGGACCAGGG + Intronic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1174383454 20:50172259-50172281 CCTTCTGTCCCGCTGGCCTAGGG - Intergenic
1174842350 20:53912146-53912168 CCAACTGGCCTGCAGGCCCAGGG - Intergenic
1175383182 20:58577522-58577544 TCTTCTGGCCAGAAGGCACAGGG + Intergenic
1175730144 20:61348956-61348978 CCTCCTGTCCTGGCTGCCCAGGG + Intronic
1176279558 20:64292709-64292731 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1178365749 21:31987562-31987584 TCCTCTGTCCTGAAGACACATGG + Intronic
1178599919 21:33986350-33986372 ACTTCTGTCTTGAGGGCCAAGGG - Intergenic
1181039497 22:20185073-20185095 CCTTGTGGGCTGAAGGCCAAGGG + Intergenic
1181106500 22:20578909-20578931 CCCTCTGTCTTGACGGCTCATGG + Intronic
1181311186 22:21945842-21945864 CCTGCTGCCCAGAAAGCCCATGG + Exonic
1181359815 22:22325629-22325651 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1181368850 22:22400275-22400297 CTTTTTGTCCTGAAGGGGCAGGG - Intergenic
1181369880 22:22407362-22407384 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1181859807 22:25809434-25809456 CCTTTTTCTCTGAAGGCCCATGG + Intronic
1183640758 22:39090972-39090994 CCTTCCGTCCTGCAGGCTCAGGG - Intergenic
1184832589 22:46998587-46998609 CCTTCTGTGCTAAAGGCGCAGGG - Intronic
1185343410 22:50301302-50301324 CTTTCTGACCCGAAGGACCACGG - Intronic
949414613 3:3800745-3800767 CCTTCTGGGCTCAAGGCTCACGG - Intronic
949741484 3:7239350-7239372 CCGTCTTTCCTCAAAGCCCACGG - Intronic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
950456381 3:13095223-13095245 CCGTCGTTCCTGAAGGCCCCAGG + Intergenic
950496200 3:13335888-13335910 CATCCTGTCATGAAGGCCCCTGG - Intronic
952711949 3:36440407-36440429 CCTGCTGTCCTGCAGGCATAAGG - Intronic
953455854 3:43041911-43041933 CTTTCCATCCTGAAGGCCCCAGG + Intronic
954321946 3:49838288-49838310 CCTGCTGGCCTGAAAGCCAAGGG + Intronic
954437649 3:50504364-50504386 CTTTCTGTCCTGGAGGCCCCTGG + Intergenic
954438027 3:50506185-50506207 CTTTCTGTCCTGGAGGCCCCTGG + Intergenic
954684443 3:52362737-52362759 CTGTTTCTCCTGAAGGCCCAGGG - Intronic
954685631 3:52368727-52368749 CCGTCTGTCCTGCAGCGCCAGGG - Exonic
954930008 3:54273003-54273025 CCGGCTGTCCTCACGGCCCATGG - Intronic
955523900 3:59801812-59801834 CCTTCTGGCCTGAGGCTCCATGG + Intronic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
961593199 3:127996196-127996218 CCATCTGTCCTGGGGCCCCAGGG + Intergenic
961747319 3:129072881-129072903 CTTTCTTTCCTGGAGTCCCATGG + Intergenic
962259303 3:133893019-133893041 CCTTCTGTCAGGGAGTCCCAAGG - Intronic
962839086 3:139217550-139217572 ACCTCTGTCCTGAACTCCCAGGG - Intronic
967319410 3:188180404-188180426 CATGCTGCCCTGATGGCCCAAGG + Intronic
967545659 3:190724143-190724165 CCTTCTGGAGTGAAAGCCCAAGG - Intergenic
968371733 3:198226019-198226041 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
968562844 4:1294171-1294193 CCTTCTGCCCAGAAGAGCCATGG + Intronic
968753942 4:2405196-2405218 GCTTCTCTCCTGAAGGCCCCAGG - Intronic
968869892 4:3236493-3236515 CCATCTCTCCTGAGGGCTCAGGG + Intronic
969721934 4:8896865-8896887 CCTTCTGCCCTGCATGCCCAAGG - Intergenic
969860778 4:10033871-10033893 CCCTGTGTCCTTAAGCCCCAGGG + Intronic
970302709 4:14698191-14698213 CCTTCAGTCATGAAGCCACAAGG + Intergenic
973563934 4:52164714-52164736 CCTTCTGTCCTGGATGCCAGTGG - Intergenic
973870052 4:55157607-55157629 CCTGCAGCCCTGACGGCCCAGGG - Intergenic
978088269 4:104682696-104682718 CCTTCTGTCTTGAAAGAGCAAGG - Intergenic
979095459 4:116544269-116544291 ACTCCTGTCCTGATGGCCCCTGG - Intergenic
979260421 4:118638497-118638519 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
982326844 4:154137145-154137167 CCTTCAAGCCTGAAGACCCATGG - Intergenic
985677930 5:1242030-1242052 CCTTCTGTCCTCAGGGCTTAAGG - Intronic
985998826 5:3613984-3614006 CTTTCAGTCCTGAAGGCCGAGGG - Intergenic
986747347 5:10756180-10756202 CCTTCTGTCAAGGTGGCCCATGG - Intronic
988603689 5:32662522-32662544 CCTTTAATCCTGAACGCCCATGG - Intergenic
991701890 5:69323844-69323866 CACTCTGTCCTGGAGGCACAAGG - Intronic
992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG + Intergenic
993155486 5:84216989-84217011 AGTTCAGACCTGAAGGCCCATGG + Intronic
996039788 5:118796879-118796901 CCTTCTGTACCGAAGACCCTAGG - Intergenic
996164669 5:120210351-120210373 CCTTCATTCCTGAAGGGTCAGGG + Intergenic
997295159 5:132764418-132764440 CCTCCTGTCCTCACTGCCCAGGG - Exonic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999624176 5:153502644-153502666 CCTGCTGTCCAGAAAGCACAGGG + Intronic
999772738 5:154787721-154787743 TCCTCTGTCCTGAAAACCCACGG - Intronic
1000861028 5:166456347-166456369 CCTTCTTTTCTGAGGGCCAAGGG - Intergenic
1000916912 5:167093733-167093755 CCTTCTGTTCTGGAAGCCTAAGG - Intergenic
1001695224 5:173664817-173664839 ACTTCTGTCCCCAAGGCCCACGG - Intergenic
1002592376 5:180299633-180299655 ACTTCTGTCCTCCAGGCCCTGGG - Intergenic
1002730973 5:181331565-181331587 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1002753560 6:142539-142561 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1002989736 6:2227697-2227719 CCTTCTGTTCTGGAATCCCAGGG - Intronic
1003127107 6:3364006-3364028 CCTTCTGTTGTGTGGGCCCATGG - Intronic
1005805686 6:29472298-29472320 CCTTCTGTGCTCTAGGGCCAGGG + Intergenic
1006436688 6:34029398-34029420 ACTTGTTTCCTGAAGGCACAGGG + Intronic
1006745197 6:36336729-36336751 GCTTCTGTCCTGAACACCCTGGG + Exonic
1006979529 6:38135865-38135887 CCTTCTGGACTGCAGGCTCAAGG - Intronic
1010767795 6:79796102-79796124 CCTTCAGAGCTGTAGGCCCATGG + Intergenic
1011185686 6:84673199-84673221 CTTTTTGTACTGTAGGCCCATGG + Intergenic
1013990993 6:116253621-116253643 CCTTCTGCCCAGCAGGGCCACGG + Exonic
1018223381 6:161604476-161604498 CGTTCTGCCCTAAAGGCCTAGGG - Intronic
1018425512 6:163676753-163676775 CCTTCATTCCTGAAGGCTCTGGG - Intergenic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1019998549 7:4741045-4741067 CCCTCTCTCCTGGGGGCCCAAGG - Intronic
1021046872 7:15933793-15933815 ACTTCTATCCTGAAGTCCCACGG + Intergenic
1022500201 7:30878011-30878033 CCTTCTGTCCCCAAGTCCCTCGG + Intronic
1023402138 7:39798097-39798119 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1024076119 7:45818727-45818749 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1024647485 7:51382563-51382585 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025051319 7:55737058-55737080 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025060085 7:55798313-55798335 CCACCTGCCCTGAAAGCCCAGGG + Intronic
1025128284 7:56362725-56362747 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025176666 7:56805606-56805628 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025695126 7:63770780-63770802 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1026902121 7:74043182-74043204 CCCTCTGTCCTCCAGCCCCAGGG - Intronic
1027149594 7:75723477-75723499 TCTTCTGTCCTGGAGGGCCTGGG + Intronic
1032052651 7:128658490-128658512 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1036695014 8:10968535-10968557 CCTCCTGTCCTCCAGGCCTAGGG + Intronic
1036795750 8:11755259-11755281 CATCCTGTCCTGAAAGGCCAGGG - Intronic
1037841828 8:22250406-22250428 CCTACTGTCTCCAAGGCCCACGG - Exonic
1039552511 8:38453294-38453316 CCGTCTCCCCTGGAGGCCCAGGG + Intronic
1039972367 8:42331121-42331143 CCTGCTGCACTGATGGCCCAGGG + Exonic
1041441164 8:57898526-57898548 CCTTTTGTCCTGTTTGCCCAGGG + Intergenic
1041628875 8:60062363-60062385 CTCTCTGTCCAGGAGGCCCATGG - Intergenic
1042207697 8:66345520-66345542 CTTTCAGTTCTGAAGGCCCCGGG - Intergenic
1046038505 8:108873835-108873857 CATTCTGGGCTGAATGCCCAAGG + Intergenic
1046500478 8:115070087-115070109 CCTTCAGTCCTGAAGGGTCTGGG - Intergenic
1047034752 8:120925119-120925141 CCTTCTGACTTCAAAGCCCAGGG - Intergenic
1048908002 8:139106874-139106896 CCTTCAGTAGTGAAGGCACATGG - Intergenic
1048928466 8:139291707-139291729 GGTTTTGTCCTGAAGGACCAGGG + Intergenic
1049594212 8:143475996-143476018 CCCTCTGCCCTGCAGCCCCAGGG - Intronic
1051835986 9:21338192-21338214 ACCTTTTTCCTGAAGGCCCAAGG + Intergenic
1052777069 9:32742896-32742918 CTTTCTGTCCTTCCGGCCCAAGG - Intergenic
1052794655 9:32912250-32912272 GATTCTCTCCTGCAGGCCCATGG - Intergenic
1052856016 9:33407031-33407053 TGCTCTGTCCTGAAGGCCCATGG - Intergenic
1055437885 9:76310686-76310708 CCTCCTGTCCCCAAGGCACATGG + Exonic
1056313984 9:85371053-85371075 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
1056884785 9:90430891-90430913 CCTTTTGTTCAGAAGGCCCTGGG - Intergenic
1057272574 9:93659159-93659181 CCGTCAGGCCTCAAGGCCCAGGG + Intronic
1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG + Intergenic
1058543916 9:106040863-106040885 CCTTCATTCCTGAAGGGCCTGGG + Intergenic
1058869846 9:109192151-109192173 CCTCTTGTCCTGGAGGCTCAGGG - Intronic
1061247930 9:129410766-129410788 CTTGCTGTTCTGAAGGCCAAAGG + Intergenic
1062755379 9:138284072-138284094 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1203579292 Un_KI270745v1:28244-28266 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1186279770 X:7978997-7979019 CCTTCATTCCTGAAGGGCCTGGG - Intergenic
1187478444 X:19632813-19632835 CCTTCTGTCCTGAATCATCAAGG - Intronic
1188286591 X:28333617-28333639 GCTTCTGTCTTGATGGCCCAAGG - Intergenic
1192177201 X:68893471-68893493 CCTTCTGCCCTGCAGGCCTGAGG + Intergenic
1193665448 X:84310306-84310328 CCATGTTTCCTCAAGGCCCAAGG - Intergenic
1194385982 X:93255724-93255746 TCTTGTCTCCTGTAGGCCCAGGG - Intergenic
1194765274 X:97841980-97842002 CCCTCCGTCCTGTAGGCCCCGGG + Intergenic
1200086955 X:153611647-153611669 CCTTCTGCCCTGGGGGCACAAGG - Intergenic
1202080886 Y:21083060-21083082 CCTTCTGTCAGCAAGGTCCAGGG - Intergenic
1202381899 Y:24280866-24280888 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1202488885 Y:25389259-25389281 CCACCTGCCCTGAAAGCCCAGGG + Intergenic