ID: 1018905454

View in Genome Browser
Species Human (GRCh38)
Location 6:168073083-168073105
Sequence TGGACTTTTCCCAGTTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 912}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018905454_1018905459 22 Left 1018905454 6:168073083-168073105 CCCTGAAAACTGGGAAAAGTCCA 0: 1
1: 0
2: 4
3: 69
4: 912
Right 1018905459 6:168073128-168073150 AGACTGACATCTGCTGCTCCCGG No data
1018905454_1018905460 23 Left 1018905454 6:168073083-168073105 CCCTGAAAACTGGGAAAAGTCCA 0: 1
1: 0
2: 4
3: 69
4: 912
Right 1018905460 6:168073129-168073151 GACTGACATCTGCTGCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018905454 Original CRISPR TGGACTTTTCCCAGTTTTCA GGG (reversed) Intronic
900084543 1:885037-885059 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
900723526 1:4197925-4197947 TTGTCTTTTTCCAGTTCTCAGGG - Intergenic
902175320 1:14645813-14645835 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
902329309 1:15723345-15723367 GGGACTTTTTCCAGATTTCCGGG - Intronic
902581269 1:17409310-17409332 GGGGCTTTTTGCAGTTTTCAAGG - Intronic
903133838 1:21296581-21296603 TTGACATTGCCCAGTTCTCAAGG + Intronic
905525081 1:38631214-38631236 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
906059922 1:42941880-42941902 AGGACTTTTCCAAGTTTGCTGGG - Intronic
906957883 1:50391119-50391141 TTGTCTTTTGCCAGTTTTCAAGG + Intergenic
907141181 1:52186394-52186416 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
907550395 1:55300059-55300081 AGGACTTCTCCCAGCTCTCATGG + Intergenic
907634789 1:56123243-56123265 TTGGCTTGTGCCAGTTTTCAAGG + Intergenic
908879327 1:68712725-68712747 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
908935400 1:69370015-69370037 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
908981158 1:69960906-69960928 TTGTCTTTTGCTAGTTTTCAAGG - Intronic
909058676 1:70853165-70853187 AGGACTTTTCCCAGTTTCACTGG - Intronic
909136994 1:71813995-71814017 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
909178175 1:72386399-72386421 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
909202918 1:72714854-72714876 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
909327142 1:74364810-74364832 TTGACTTTTCCAAGTTTTATAGG - Intronic
909333474 1:74444084-74444106 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
909404580 1:75273443-75273465 TTGTCTTTTTCCAGTTCTCAGGG + Intronic
909679163 1:78272098-78272120 TGTCCTTTGCCCAGTTTTTATGG + Intergenic
909882828 1:80901638-80901660 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
910308079 1:85789617-85789639 TTGCCTTGTGCCAGTTTTCAAGG + Intronic
910642367 1:89477362-89477384 TTGCCTTGTGCCAGTTTTCAAGG - Intergenic
910736347 1:90462091-90462113 TCGTCTTGTCCCAGTTTTCAGGG - Intergenic
910764485 1:90767560-90767582 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
911424124 1:97685417-97685439 TTGTCTTATGCCAGTTTTCAAGG - Intronic
911923308 1:103794598-103794620 TGCCCTTTTCCAAGTTTGCAGGG - Intergenic
915052357 1:153088907-153088929 TGGACAATACCCCGTTTTCAAGG + Intergenic
915816077 1:158966786-158966808 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
915897824 1:159825207-159825229 AGAACTTAACCCAGTTTTCAAGG + Intergenic
915999574 1:160601962-160601984 TTGCCTTCTTCCAGTTTTCAGGG + Intergenic
916427338 1:164693268-164693290 TGGCCTTTGCCTGGTTTTCAGGG + Intronic
916566453 1:165983033-165983055 TGGTCTTTTCCCAGTTCCCCTGG + Intergenic
916816240 1:168355744-168355766 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
916979526 1:170118202-170118224 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
917007416 1:170430503-170430525 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
917269999 1:173262405-173262427 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
917746593 1:178014789-178014811 TTGTCTTGTCCCAGTTCTCAAGG + Intergenic
917984418 1:180300428-180300450 TGGATTCTTGCCAGTTTTTAAGG - Intronic
918600726 1:186356826-186356848 AGGACTTGTCCTAGATTTCAGGG - Intronic
918620088 1:186593662-186593684 TTGTCTTTTTCCAGTTCTCAAGG - Intergenic
918684659 1:187399418-187399440 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
918819446 1:189233488-189233510 TGGTCTTGTTCCAGTTCTCAGGG + Intergenic
919018936 1:192078040-192078062 TGGCCTTTTCCCTGATTTCTGGG - Intergenic
919164748 1:193877844-193877866 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
919220948 1:194627725-194627747 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
919234989 1:194829270-194829292 TTGTCTTGTACCAGTTTTCAAGG + Intergenic
921116344 1:212095159-212095181 TTGTCTTTTTCCAGTTCTCATGG + Intronic
921242460 1:213199571-213199593 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
921303874 1:213776248-213776270 TGGACTTTTCCCAGATCTGTCGG + Intergenic
921787772 1:219252347-219252369 TTGTCTTGTCCCAGTTTTCAAGG + Intergenic
921919088 1:220645983-220646005 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
922397766 1:225220232-225220254 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
922679089 1:227575810-227575832 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
923945885 1:238886945-238886967 TTGCCTTGTGCCAGTTTTCAAGG - Intergenic
924412757 1:243823349-243823371 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1063195776 10:3741447-3741469 TGGACTTTTACCAGCTATCTGGG - Intergenic
1063334886 10:5202572-5202594 TTGTCTTATTCCAGTTTTCAGGG + Intronic
1063381026 10:5586020-5586042 TGGTCTCATCCCAGTTGTCAAGG + Intergenic
1063915184 10:10874409-10874431 TGCACTTTACCCAGATTCCATGG + Intergenic
1063957079 10:11277075-11277097 TGGAATATTCACAGTCTTCAAGG + Intronic
1063966096 10:11347105-11347127 TGTACCTTGCCCAGATTTCAAGG + Intergenic
1065246373 10:23762692-23762714 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1065453410 10:25881760-25881782 TGGACAATACCCAGCTTTCAAGG + Intergenic
1065661034 10:28004374-28004396 ATGTCTTTTCCCAGTTTTGATGG - Intergenic
1065916029 10:30355654-30355676 GGAACTTTTCCCACTTTGCAGGG + Intronic
1066170682 10:32841073-32841095 TTGTCTTGTTCCAGTTTTCAGGG - Intronic
1066509416 10:36079660-36079682 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1066706919 10:38190337-38190359 TGGACTTTTCTTAGTTGTTAGGG - Intergenic
1066784546 10:38988879-38988901 TTGTCTTTTTCCAGTTCTCAGGG - Intergenic
1067050742 10:43018174-43018196 TTGACTTGTGCCAGTTTTCAAGG + Intergenic
1067138742 10:43636156-43636178 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1067226814 10:44382138-44382160 TGGCTTTTTCCTGGTTTTCAGGG - Intronic
1067233797 10:44430389-44430411 TTGTCTTTTTCCAGTTCTCAGGG + Intergenic
1067765916 10:49086378-49086400 TGTACTTGTCCCAGTATTCCTGG + Intronic
1068380797 10:56251559-56251581 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1068409653 10:56638475-56638497 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1068441454 10:57060483-57060505 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1068481092 10:57589353-57589375 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
1068560683 10:58511982-58512004 AGGGCTTTTCTCTGTTTTCAAGG - Intergenic
1068906013 10:62323626-62323648 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1069805547 10:71121303-71121325 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
1069811587 10:71164128-71164150 TTGTCTCTTGCCAGTTTTCAAGG - Intergenic
1070445880 10:76501678-76501700 TGTCCTTTTCCCATTTTTGATGG + Intronic
1070870921 10:79752044-79752066 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1071454998 10:85840411-85840433 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1071552534 10:86577989-86578011 TTGACTTTTCACATTTTTGATGG + Intergenic
1071637849 10:87274255-87274277 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1071657395 10:87463695-87463717 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1071999582 10:91181422-91181444 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1072054106 10:91736695-91736717 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1072065545 10:91866822-91866844 TTGAGTTTTCCCACTTGTCACGG + Intergenic
1072410520 10:95197853-95197875 TGGACGATACCCAGCTTTCAAGG + Intronic
1072480663 10:95807985-95808007 TTGCCTTGTGCCAGTTTTCAAGG + Intronic
1072708561 10:97700164-97700186 TGGACAATACCCAGCTTTCAAGG - Intergenic
1073556817 10:104461537-104461559 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1074645770 10:115450206-115450228 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1076174495 10:128357131-128357153 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1077677644 11:4210728-4210750 TGGTCTTTTCCAAGTCTTCTGGG + Intergenic
1078295207 11:10061277-10061299 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1078724768 11:13920199-13920221 TGGTCAGTTCCCATTTTTCAGGG + Intergenic
1079298099 11:19252909-19252931 TGTGCTTTTTCCAGTTTTCAAGG - Intergenic
1079495269 11:21035808-21035830 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1079579993 11:22052204-22052226 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1080196576 11:29616909-29616931 TTGCCTGTTCCCATTTTTCAGGG + Intergenic
1080329883 11:31124086-31124108 TTGTCTTGTACCAGTTTTCAAGG + Intronic
1080500580 11:32866889-32866911 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1080513310 11:32997083-32997105 TTGTCTTGTACCAGTTTTCAAGG + Intergenic
1080591516 11:33727597-33727619 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1081132482 11:39397230-39397252 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1083069137 11:59959018-59959040 TGCACTTTGCCCACTTTTTATGG - Intergenic
1083133445 11:60648585-60648607 TGGAGTTTTCCATGTTTTAATGG + Intergenic
1083345663 11:61989364-61989386 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1083495744 11:63051456-63051478 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1083495798 11:63052069-63052091 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1083527728 11:63385860-63385882 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1084253472 11:67921606-67921628 TGGACAATACCCAGCTTTCAAGG - Intergenic
1084722622 11:70917183-70917205 TGTCCTTTGCCCACTTTTCAAGG - Intronic
1085334801 11:75684211-75684233 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1085411342 11:76292443-76292465 TGGAGTTTTCCAAGGTGTCAAGG - Intergenic
1085813822 11:79713934-79713956 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1085860929 11:80234795-80234817 TTGTTTTTTACCAGTTTTCAAGG - Intergenic
1086086861 11:82964358-82964380 TTGTCTTCTGCCAGTTTTCAAGG + Intronic
1086280119 11:85175537-85175559 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1086496897 11:87413366-87413388 TTGTCTTTTGCCAGTTTTCAAGG - Intergenic
1086522756 11:87689324-87689346 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
1086560795 11:88166732-88166754 AGGACATTTCCCAGTTTTCATGG + Intronic
1086574483 11:88323344-88323366 TTGTCTTGTGCCAGTTTTCACGG - Intronic
1086963441 11:93004026-93004048 TTGACTTTTACCACTGTTCAGGG - Intergenic
1086991442 11:93307913-93307935 TTGTCTTATTCCAGTTTTCAAGG - Intergenic
1087337216 11:96859755-96859777 TTGTCTTGTGCCAGTTTTCAGGG + Intergenic
1087368599 11:97252519-97252541 TGCAAATTTCCCAGTTTTCAAGG + Intergenic
1087692981 11:101343457-101343479 TGTCCTTTACCCAGTTTTTAAGG + Intergenic
1087881637 11:103422761-103422783 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1088475445 11:110233446-110233468 TGGTCTTTTCCAAGTCTTCCTGG + Exonic
1089104600 11:115991840-115991862 TGTACTTTTCCCATGTTCCAGGG - Intergenic
1089885055 11:121812700-121812722 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1090039718 11:123280028-123280050 TGGACAATACCCAGTTTTCAAGG - Intergenic
1090091263 11:123700590-123700612 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1090321570 11:125848959-125848981 TTGTCTTTTGCCAGTTTTCAAGG - Intergenic
1092639544 12:10489165-10489187 TTGTCTTTTTCTAGTTTTCAAGG + Intergenic
1092837226 12:12502168-12502190 TGCACTTCTAGCAGTTTTCAAGG - Intronic
1093032472 12:14301075-14301097 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1093452212 12:19328900-19328922 TTGTCTTTTTCCAGTTCTCAAGG + Intronic
1093862712 12:24186990-24187012 TAAACTTTTCCAAGTTTTGATGG - Intergenic
1094156379 12:27341173-27341195 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1094273530 12:28643632-28643654 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1094431661 12:30376334-30376356 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1095333846 12:41003010-41003032 TGGTCTTGTGCCAGTTTTCAAGG + Intronic
1095509965 12:42940534-42940556 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1095551563 12:43447567-43447589 TTGTCTTCTGCCAGTTTTCAAGG - Intronic
1095610703 12:44124469-44124491 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1096035943 12:48470494-48470516 TGTCCTTTGCCCATTTTTCATGG + Intergenic
1096353296 12:50917802-50917824 TTAACTTTTCCCAGTTTGGAGGG - Intergenic
1097098116 12:56566117-56566139 TGTTCTGTTCCCAGCTTTCAGGG + Intronic
1097761143 12:63465794-63465816 TTGTCTTGTGCCAGTTTTCATGG + Intergenic
1097841392 12:64325117-64325139 TGGACTTTTGCCATTATTCCAGG + Intronic
1097916746 12:65028940-65028962 TTGTCTTGTCCCAGTTCTCAAGG + Intergenic
1098686750 12:73432400-73432422 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
1099130825 12:78828460-78828482 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1099706432 12:86159099-86159121 TTGTCTTTTTCCAGTTCTCAAGG + Intronic
1099771571 12:87065455-87065477 TTGTCTTTTTCCAGTTTTCAAGG - Intergenic
1099845420 12:88022428-88022450 TTGTCTTCTTCCAGTTTTCAAGG - Intronic
1100177510 12:92047742-92047764 TGGAATTTTCCCAGTGCTCAAGG + Intronic
1100196814 12:92255769-92255791 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1100667070 12:96766797-96766819 TTGTGTTTTCCCAGTTTTTAGGG + Intronic
1101586706 12:106091455-106091477 AAGACTTTTCCCAGTTTGGAGGG + Intronic
1101798258 12:107997696-107997718 TGGACAATACCCAGCTTTCAAGG + Intergenic
1102091977 12:110198503-110198525 TAGACTTTTTCCAGAATTCATGG - Intronic
1102309198 12:111831229-111831251 CTGTCTTTTGCCAGTTTTCAAGG + Intergenic
1104082225 12:125439734-125439756 TTGTCTTGTGCCAGTTTTCATGG + Intronic
1105732365 13:23230855-23230877 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1105776188 13:23663083-23663105 TTGCCTTGTGCCAGTTTTCAAGG + Intronic
1105818635 13:24059911-24059933 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1106349367 13:28913179-28913201 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1106425864 13:29628830-29628852 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1106958537 13:34971419-34971441 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1107096502 13:36543188-36543210 TGTACTTTTCTCATTTTCCAGGG - Intergenic
1107241070 13:38234806-38234828 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1107581589 13:41794700-41794722 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1108031855 13:46240076-46240098 TTGACTTGTTCCAGTTTTTAAGG - Intronic
1108189349 13:47921579-47921601 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1108815982 13:54290817-54290839 TGGTCTTTGCCCACTTTTTAAGG + Intergenic
1109096880 13:58130146-58130168 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1109106768 13:58262536-58262558 TTGACTTGTTCTAGTTTTCAGGG - Intergenic
1109325783 13:60866137-60866159 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1109484873 13:63005713-63005735 TTGTCTTTTTCCAGTTCTCAGGG - Intergenic
1109577535 13:64281547-64281569 TGTTATTTTCCCAGTTTTAATGG - Intergenic
1110488787 13:76078270-76078292 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1110498177 13:76193744-76193766 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1110501703 13:76235830-76235852 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1110525713 13:76534229-76534251 TTGTCTTGTCCCAGTTTTCAAGG - Intergenic
1110557524 13:76877196-76877218 TGGACTTTACACACATTTCATGG - Intergenic
1110588289 13:77221641-77221663 TGCACCTTTCCCAGTTTCTATGG + Intronic
1110812302 13:79824249-79824271 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1110821467 13:79922273-79922295 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
1111307115 13:86428945-86428967 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1111402219 13:87754097-87754119 TGGAAGTTTCCTATTTTTCAGGG - Intergenic
1111457532 13:88504531-88504553 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1111555502 13:89876055-89876077 TTGACGTTTATCAGTTTTCATGG - Intergenic
1111603758 13:90508939-90508961 AGGAATTTTCCCAGTTCTGATGG + Intergenic
1112102570 13:96205888-96205910 CTGTCTTTTGCCAGTTTTCAAGG - Intronic
1112254109 13:97813147-97813169 TTGTCTTTTTCCAGTTTTCCAGG - Intergenic
1112700800 13:102005654-102005676 TGGACTTTTCCGTGTTTTATTGG - Intronic
1113534585 13:111055142-111055164 TAGTCTTTTTCCAGTTCTCAGGG + Intergenic
1113960543 13:114123434-114123456 TGGCCTTTTCCCTGCTTTGAGGG - Intronic
1113967230 13:114160794-114160816 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1114867564 14:26615842-26615864 TTGTCTTGTCCCAGTTCTCAAGG - Intergenic
1115045075 14:28981962-28981984 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1115432158 14:33331773-33331795 GAGACTTTTCACAGTTTTCTTGG + Intronic
1115492756 14:33973964-33973986 TGGGCATCTCCCAGTTTTTAAGG - Intronic
1115926774 14:38444727-38444749 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1116132125 14:40867600-40867622 TGTCCTTTGCCCAGTTTTAATGG - Intergenic
1116344689 14:43776656-43776678 TTGACTTTTGCTGGTTTTCAAGG - Intergenic
1116471731 14:45293414-45293436 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1116504449 14:45661568-45661590 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1116544733 14:46150680-46150702 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1116708730 14:48337377-48337399 TTGTCTTGTACCAGTTTTCAAGG + Intergenic
1116976966 14:51127281-51127303 TTGTCTTGTTCCAGTTTTCAGGG + Intergenic
1117111414 14:52459981-52460003 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1117481253 14:56147637-56147659 GGGTATTTTCCCAGATTTCATGG - Intronic
1117641409 14:57803379-57803401 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1117668621 14:58082760-58082782 TGGAGTTTTCCCAGTTTTCTGGG + Intronic
1117751409 14:58927760-58927782 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1117820979 14:59648861-59648883 TCGTCTTATGCCAGTTTTCAGGG - Intronic
1117857167 14:60047343-60047365 TTGTCTTATGCCAGTTTTCAAGG + Intronic
1117889733 14:60406517-60406539 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1119463710 14:74835112-74835134 ATGGCTTTTCCCAGTTTTCCTGG + Intronic
1119582350 14:75797480-75797502 TTGTCTTGTTCCAGTTTTCAAGG + Intronic
1119588935 14:75866732-75866754 TGGACATCTCTCAGTATTCATGG + Intronic
1119979796 14:79067033-79067055 TTGTCTTGTGCCAGTTTTCAGGG + Intronic
1120151684 14:81043015-81043037 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1120300683 14:82702428-82702450 TTGCCTTTTGCCAGTTTTCAAGG + Intergenic
1120785318 14:88529043-88529065 TTGTCTTGTTCCAGTTTTCAGGG + Intronic
1120803593 14:88720700-88720722 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1121143273 14:91560660-91560682 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1121503549 14:94459087-94459109 TGGTCTTTTCCCAGTATTTCTGG + Intergenic
1121575760 14:94985260-94985282 TTGACTTTTTCCTGTTCTCAGGG - Intergenic
1122704379 14:103610926-103610948 TGGCATTTTCCCTGTGTTCATGG - Intronic
1123215394 14:106804701-106804723 TGCATTTGTCCCAATTTTCAAGG + Intergenic
1124122777 15:26905024-26905046 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1124367651 15:29084629-29084651 TTGCATTTTCCCAGTTTACAGGG + Intronic
1124894992 15:33768047-33768069 TGGGCCTTTCCTAGTTTCCAAGG + Intronic
1125077933 15:35641701-35641723 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1125271770 15:37946919-37946941 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1125373636 15:39004783-39004805 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1125707832 15:41756116-41756138 TTGGCTTTTCACTGTTTTCACGG - Intronic
1125982520 15:44015811-44015833 TTGCCTTTGCCCAGTATTCAAGG + Intronic
1126219240 15:46193453-46193475 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1126304105 15:47235159-47235181 TGTAATTTTCCCACTTTTTATGG + Intronic
1126876960 15:53053681-53053703 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1126928838 15:53624004-53624026 ACGACTTTTCCCATTTTTAATGG + Intronic
1126977611 15:54201738-54201760 TTGACTTGTTCCAGTTCTCAGGG - Intronic
1127100529 15:55560108-55560130 TTGTCTTTTGCCAGTTTTCAAGG - Intronic
1127559592 15:60122698-60122720 TGCAGTTTTCTCAGTTTTCAAGG - Intergenic
1127616709 15:60693374-60693396 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1127858913 15:62976820-62976842 GGGACTTTTCCAAGTCTCCAAGG - Intergenic
1128850607 15:70951827-70951849 TTGTCTTTTTCCAGTTCTCAAGG + Intronic
1129553908 15:76484977-76484999 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1129585009 15:76853741-76853763 TTGTCTTATGCCAGTTTTCAGGG - Intronic
1130079080 15:80715766-80715788 TCGACTTTTACATGTTTTCAGGG + Intronic
1131103382 15:89712500-89712522 TGGCCTTTCCTCATTTTTCAAGG + Intronic
1131591226 15:93750735-93750757 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1132489753 16:221023-221045 TTGGCTTTTGCCAGTTTTTAAGG + Intronic
1132814545 16:1819461-1819483 TGGATTTGGCCCAGTTTTGAAGG - Intronic
1133873372 16:9710452-9710474 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1134007861 16:10830116-10830138 TGGACAATACCCAGCTTTCAAGG + Intergenic
1135375431 16:21943047-21943069 TGTTCTTGTGCCAGTTTTCAAGG + Intergenic
1136245488 16:28973648-28973670 TGGCATTTTACCAGGTTTCAGGG - Intergenic
1136729489 16:32395589-32395611 TTGTCTTTTTCCAGTTCTCAGGG + Intergenic
1137839934 16:51631124-51631146 AGGACGTTTCCCACTTGTCATGG + Intergenic
1138542086 16:57694735-57694757 TGTAGTCTTCCCAGGTTTCATGG - Intergenic
1139141445 16:64267579-64267601 TGGATTTTTACCATTTCTCAAGG - Intergenic
1139254278 16:65526478-65526500 TGGGCTTTGCCCAGTATTTAGGG - Intergenic
1140173005 16:72627062-72627084 TGAACTTTTCACACATTTCAGGG - Intergenic
1140544458 16:75792848-75792870 TGGACTCTTCCATGTTTTCCTGG + Intergenic
1140783766 16:78319885-78319907 GGCACTTTTTCCAGTTTTCCTGG + Intronic
1202996907 16_KI270728v1_random:121704-121726 TTGTCTTTTTCCAGTTCTCAGGG - Intergenic
1203023594 16_KI270728v1_random:434046-434068 TTGTCTTTTTCCAGTTCTCAGGG - Intergenic
1142555914 17:777320-777342 TGGACTGTTCCAACTTGTCACGG + Intronic
1143712067 17:8742070-8742092 TGGACTTTTCTCAGTCTTCTCGG - Intronic
1146574285 17:33978104-33978126 TGGATCTTTCCCAGGTTTGAAGG + Intronic
1148195315 17:45708874-45708896 TGGGCTTTTCCCAGTCTCCAGGG + Intergenic
1149127964 17:53258323-53258345 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1149160106 17:53682910-53682932 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1149235392 17:54584132-54584154 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1149395446 17:56236838-56236860 TTGACTTGTGCCAGTTTTCAAGG + Intronic
1149411557 17:56413490-56413512 TTGTCTTATGCCAGTTTTCAAGG + Intronic
1149989105 17:61370732-61370754 TGGAAGTTACCCAGTTTCCATGG + Intronic
1150568191 17:66361642-66361664 TGGACTCTACCCAGTCTTCCTGG + Intronic
1151539561 17:74758170-74758192 TCGACTTTCCCCAGCTTTCCAGG + Intronic
1152226102 17:79093584-79093606 TGGATTTTTCCCATCTTTCTTGG - Intronic
1153175986 18:2373834-2373856 TTGTCTTGTTCCAGTTTTCAGGG + Intergenic
1153351748 18:4088876-4088898 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1153427648 18:4984260-4984282 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1153460373 18:5326282-5326304 TTGCCTTCTGCCAGTTTTCAAGG - Intergenic
1155027355 18:21953881-21953903 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1155091208 18:22513527-22513549 TTGTCTTTTGCCTGTTTTCAAGG + Intergenic
1155190957 18:23429826-23429848 TGTACTTTGCCCACTTTTAAAGG + Intronic
1156563248 18:38153565-38153587 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1157683977 18:49628306-49628328 TGGACTTCTGCCAGTGTGCAGGG - Intergenic
1157770272 18:50339569-50339591 TGGCCTGCTCCCTGTTTTCAAGG - Intergenic
1157924396 18:51747235-51747257 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1158337527 18:56429793-56429815 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1158688602 18:59639568-59639590 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1158822923 18:61181585-61181607 TGTCCTTTTCCCATTTTTAATGG - Intergenic
1158921255 18:62193430-62193452 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1159077033 18:63692124-63692146 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1159564621 18:70034619-70034641 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1159612970 18:70546841-70546863 TGGTCTTTTCCCAGTTCTTCTGG + Intergenic
1159905705 18:74089491-74089513 TTGTCTTGTTCCAGTTTTCAAGG + Intronic
1160250116 18:77195856-77195878 TAGTCTTGTGCCAGTTTTCAAGG + Intergenic
1162921753 19:13906989-13907011 TTGATTTTTCTCAGTTTTGATGG + Intronic
1162964691 19:14150326-14150348 CGGCCTTTTCCCAGTCTCCAGGG + Exonic
1163264578 19:16211435-16211457 TTGTCTTGTGCCAGTTTTCAGGG + Intronic
1163932539 19:20410786-20410808 TGTGTTTTTCCCAGTTTTCCTGG + Intergenic
1164006973 19:21158887-21158909 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1164069742 19:21756289-21756311 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1164240439 19:23383718-23383740 TTGCCTTTTGCCAGTTTTCAAGG - Intronic
1164736421 19:30544628-30544650 TGGTCTTTACTCAGTTTCCAGGG + Intronic
1164880720 19:31730542-31730564 TTGACTTTTACGAGTTCTCAGGG + Intergenic
1166172202 19:41036704-41036726 TGGACAATACCCAGCTTTCAAGG + Intergenic
1166588523 19:43973323-43973345 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1166899490 19:46048344-46048366 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1168209104 19:54876394-54876416 ATGTCTTTTGCCAGTTTTCAAGG + Intronic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
925389362 2:3484873-3484895 AGGACTCTTCCCAGTCCTCATGG - Intronic
925429434 2:3778399-3778421 TGGTTATTTCCTAGTTTTCATGG - Intronic
925532495 2:4880179-4880201 TGGTCTTTACCCCATTTTCATGG - Intergenic
925674142 2:6342514-6342536 TGGTCTTTTCCCAGTTTGAGTGG + Intergenic
926354864 2:12032363-12032385 TTGTCTTTTCCCAGCTTGCAGGG - Intergenic
926450564 2:12998898-12998920 TGGATTTTTTCCAGTTGTCTTGG + Intergenic
927266106 2:21152759-21152781 TCGTCTTCTGCCAGTTTTCAAGG - Intergenic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
928850384 2:35738327-35738349 TTGTCTTGTGCCAGTTTTCAGGG - Intergenic
929302805 2:40325332-40325354 GGGACTTTTTCCTGGTTTCAGGG - Intronic
929727470 2:44445552-44445574 TTAACTTTTCCCAGTTTGGAGGG - Intronic
929727497 2:44445722-44445744 AGGCCTTTTACCAGTTTGCATGG - Intronic
930311199 2:49742010-49742032 TGGATTTTTCCAAATCTTCAAGG + Intergenic
930423391 2:51181550-51181572 TTGACTTGTTCCAGTTCTCAGGG - Intergenic
930461955 2:51692681-51692703 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
930884606 2:56310870-56310892 AGGACTTTAGCCAGTCTTCATGG - Intronic
930935194 2:56940486-56940508 TGGGCTTTTCTAATTTTTCAAGG + Intergenic
930951746 2:57150956-57150978 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
931536185 2:63279534-63279556 TTGTCTTTTTCCAGTTCTCAGGG - Intronic
931549660 2:63428653-63428675 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
931624218 2:64242155-64242177 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
931653824 2:64491925-64491947 CAGACTTTTCCCATTTTTCTCGG - Intergenic
931873781 2:66490227-66490249 TGGATTTTTCTCAGTTTTGCAGG - Intronic
931889696 2:66657877-66657899 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
931929714 2:67117783-67117805 TTGCCTTGTGCCAGTTTTCAAGG - Intergenic
932482785 2:72057602-72057624 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
933068845 2:77833335-77833357 CAAACTTTTCCCAGTTTTTAAGG - Intergenic
933237916 2:79885821-79885843 TGGACTCTTTCCAGTGTTCTTGG - Intronic
933550291 2:83768117-83768139 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
933748285 2:85586277-85586299 TGGCCTTTTCCCAGTTTTATAGG - Intronic
934030065 2:88036520-88036542 TTGACTTTGCCTTGTTTTCAAGG - Intronic
934100234 2:88646148-88646170 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
934123881 2:88867158-88867180 TGGACAATACCCAGTTTTCCTGG + Intergenic
934592381 2:95567512-95567534 TGGACAATACCCAGCTTTCAAGG - Intergenic
935475139 2:103510475-103510497 TTGTCTTGTTCCAGTTTTCAGGG + Intergenic
935491798 2:103730334-103730356 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
935688199 2:105705245-105705267 TGTCCTTTTCCCAATGTTCATGG - Intergenic
936821100 2:116522234-116522256 TGTACTTTGCCCACTTTTTAAGG + Intergenic
936877521 2:117209846-117209868 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
937540884 2:122951542-122951564 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
937549996 2:123076089-123076111 TGGAGATTTTCCAGTTTTAATGG - Intergenic
937642587 2:124230330-124230352 GGGACTTTTTCCAGATTACAAGG + Intronic
937727616 2:125186294-125186316 AGGCCTTTTACCAGTTTGCATGG + Intergenic
937848268 2:126606036-126606058 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
939022528 2:136976235-136976257 TTGCCTTGTGCCAGTTTTCAAGG + Intronic
939487265 2:142830289-142830311 TTGATTTGTGCCAGTTTTCAAGG + Intergenic
939504142 2:143025271-143025293 TAGATTTCTCCCATTTTTCATGG + Intronic
940401113 2:153248954-153248976 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
940822294 2:158369737-158369759 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
941119391 2:161511626-161511648 TTGTCTTATTCCAGTTTTCAAGG - Intronic
941135835 2:161717358-161717380 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
941146221 2:161849467-161849489 TTGTCTTGTACCAGTTTTCAAGG + Intronic
941221851 2:162791847-162791869 TTGTCTTGTGCCAGTTTTCAGGG + Intronic
941704876 2:168647578-168647600 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
942372191 2:175296933-175296955 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
942719671 2:178937157-178937179 TTGTCTTATGCCAGTTTTCAAGG + Intronic
942843177 2:180389316-180389338 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
943030200 2:182676989-182677011 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
944021089 2:195105440-195105462 TGGTCTTGAGCCAGTTTTCAAGG - Intergenic
944163388 2:196690771-196690793 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
944163652 2:196693709-196693731 TTGCCTTTTCCCAGTTTTAGGGG + Intronic
944354116 2:198765083-198765105 TGTACTTTTACCAGGTTTCTTGG - Intergenic
944392497 2:199231317-199231339 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
944451563 2:199849284-199849306 TAGCCTTATCCCTGTTTTCAAGG + Intronic
945023916 2:205601942-205601964 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
945388240 2:209229998-209230020 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
945524375 2:210869995-210870017 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
945847534 2:214964302-214964324 TTGTCTTGTGCCAGTTTTCAGGG - Intronic
946598113 2:221328696-221328718 TGCAGTGTTGCCAGTTTTCATGG - Intergenic
946785876 2:223243575-223243597 TTATCTTGTCCCAGTTTTCATGG + Intergenic
946797647 2:223372667-223372689 GGGGCTTTTCCCAGTTTGCTTGG + Intergenic
946934928 2:224710131-224710153 GTGACTTTTCCCAGATTTCCAGG + Intergenic
947188776 2:227479203-227479225 TGGAGTTTTCCCAGTATAAAAGG - Intronic
947198290 2:227591287-227591309 TTGTCTTTTGCCAGTTTTGAAGG + Intergenic
947320366 2:228910694-228910716 TCGTCTTGTGCCAGTTTTCAAGG - Intronic
947997782 2:234543485-234543507 TTGACATTTTGCAGTTTTCATGG + Intergenic
948666646 2:239538858-239538880 TGGACCTTGCCAAGTTCTCAGGG - Intergenic
1169418739 20:5441695-5441717 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1169616179 20:7448339-7448361 TTGCCTTTTTCCAGTTCTCAGGG + Intergenic
1169658010 20:7947053-7947075 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1169678251 20:8179715-8179737 TGTTCTTGTCCCAGTTCTCAAGG + Intronic
1170167500 20:13377141-13377163 TTGTCTTGTGCCAGTTTTCAGGG + Intergenic
1170259659 20:14389827-14389849 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
1171326176 20:24295311-24295333 TAGACTTTTGCCAATTTTCAGGG - Intergenic
1171996951 20:31738956-31738978 TGGACCTCTCCAAGTTTTCAGGG - Intergenic
1172684186 20:36740912-36740934 TGGATATTTACCAGGTTTCAGGG - Intronic
1172684339 20:36742504-36742526 TGGATATTTACCAGGTTTCAGGG + Intronic
1174952972 20:55063582-55063604 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1176049836 20:63112898-63112920 TGGACTTTACTCACTTCTCATGG + Intergenic
1176700503 21:10043677-10043699 TGGACTATTCCTATTTTTCCTGG - Intergenic
1177043619 21:16143598-16143620 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
1177584438 21:23072005-23072027 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1177876761 21:26643036-26643058 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1179300781 21:40108086-40108108 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1180250007 21:46578523-46578545 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1180564899 22:16654825-16654847 TGGCCCTTTCCCAGTTCACAGGG - Intergenic
1180966819 22:19793524-19793546 TGGATATTTCCCAATTTTAATGG + Intronic
1182758920 22:32706127-32706149 TTGTCTTTTGCCGGTTTTCAAGG + Intronic
1182950235 22:34367721-34367743 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1183896180 22:40971041-40971063 AGGACTTTTCATAGTTTTCAGGG + Intronic
1184994456 22:48195222-48195244 AGGACTTTTCCTAGTGTTCCGGG - Intergenic
949958375 3:9289422-9289444 TTGTCTTTTCCCAGATCTCAAGG - Intronic
949964761 3:9346166-9346188 TGGAGTTTCCACAATTTTCAAGG + Intronic
950753066 3:15146181-15146203 TGGACAATACCCAGCTTTCAAGG + Intergenic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
951153230 3:19317900-19317922 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
951302375 3:21013943-21013965 TTGTCTTTTTCCAGTTCTCAGGG + Intergenic
951614781 3:24530411-24530433 TGGAATTTTTCCAATTTTGAGGG - Intergenic
952127783 3:30322188-30322210 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
952461218 3:33528368-33528390 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
952574875 3:34762562-34762584 TTGGCTTGTGCCAGTTTTCAAGG - Intergenic
952605572 3:35143463-35143485 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
952666933 3:35918383-35918405 TTGTCTTATTCCAGTTTTCAAGG + Intergenic
952749496 3:36813930-36813952 TGGACATTGCCTACTTTTCAGGG + Intergenic
953491568 3:43356769-43356791 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
953518325 3:43618554-43618576 TCAACTTGTCCCAGTTTTAAAGG - Intronic
954510129 3:51117029-51117051 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
955257100 3:57343531-57343553 TGGACAATACCCAGCTTTCAAGG - Intronic
955337846 3:58101803-58101825 TGGACTTTTTCAAGTCTTCTTGG - Intronic
955686276 3:61551965-61551987 TTGTCTTGTCCCAGTTCTCAGGG + Intergenic
955813214 3:62813777-62813799 TGTCCTTTGCCCACTTTTCAAGG - Intronic
956344503 3:68263205-68263227 TATACTTTTACCAATTTTCAGGG - Intronic
956375098 3:68605871-68605893 TTGTCTTTTGCCAGTTTTCAAGG - Intergenic
956612231 3:71135665-71135687 TAAACTTTTCACAGTTTTCTGGG - Intronic
956862481 3:73338728-73338750 TGGAAGTGTCCCAGTTTTCCAGG + Intergenic
957067539 3:75538067-75538089 TGGACAATACCCAGCTTTCAAGG - Intergenic
957353272 3:79052950-79052972 TGGACACTTCCCTGTTTTAACGG - Intronic
957746051 3:84344861-84344883 CTGTCTTTTACCAGTTTTCAAGG + Intergenic
958480464 3:94639778-94639800 TTGACTTTTTCCAGTTCTCAGGG + Intergenic
958523557 3:95223251-95223273 TTGTCTTTTGCCAGTTTTCAAGG + Intergenic
958679154 3:97304310-97304332 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
958732732 3:97975891-97975913 TGGACTTCTCACAGTTTTGGAGG + Intergenic
958759211 3:98287722-98287744 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
958817713 3:98934377-98934399 TGGTCTTTTGCCAGTCTTCAAGG - Intergenic
958875507 3:99611853-99611875 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
959125585 3:102286710-102286732 TTGTCTTGTTCCAGTTTTCAGGG + Intronic
959209743 3:103362620-103362642 TTGTCTTTTGCCAGTTTTCAAGG - Intergenic
959463288 3:106652728-106652750 TTGTCTTATTCCAGTTTTCAAGG - Intergenic
959779068 3:110206128-110206150 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
960019991 3:112938257-112938279 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
960503058 3:118460777-118460799 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
960679736 3:120235091-120235113 TTGTCTTGTGCCAGTTTTCAGGG + Intronic
960681588 3:120253379-120253401 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
960834673 3:121893582-121893604 TCCACTTTTCCCAGCTGTCATGG + Intergenic
961696063 3:128705786-128705808 TGGCCTGTTCCCAGCTTTAAAGG + Intergenic
962064746 3:131967297-131967319 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
962122044 3:132571990-132572012 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
962423057 3:135245042-135245064 AGGACTTTTCTCACTTTTCAGGG - Intronic
962530119 3:136271927-136271949 TTGTCTTGTTCCAGTTTTCAGGG + Intronic
962650852 3:137489115-137489137 TGGACTTATCCTAGATTTGAAGG + Intergenic
962655211 3:137536938-137536960 TGTCCTTTGCCCAGTTTTGATGG + Intergenic
962696576 3:137953797-137953819 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
962983592 3:140513174-140513196 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
963057486 3:141198521-141198543 TTGTCTTCTGCCAGTTTTCAAGG - Intergenic
963125687 3:141813624-141813646 TGGACTTTTCCCACTGTGTATGG - Intronic
963362510 3:144292677-144292699 TTGTCTTCTGCCAGTTTTCAAGG + Intergenic
963393700 3:144704168-144704190 TGGACATTAACCAGTTTTAAAGG + Intergenic
963493481 3:146030668-146030690 TTGTCTTCTGCCAGTTTTCAAGG + Intergenic
963561476 3:146871404-146871426 TTGTCTTTTTCCAGTTTTCAAGG + Intergenic
963628915 3:147709185-147709207 TTCTCTTTTGCCAGTTTTCAAGG + Intergenic
963831006 3:150009233-150009255 TTGTCTTGTGCCAGTTTTCAGGG - Intronic
963925756 3:150949282-150949304 TTGTCTTGTGCCAGTTTTCAGGG - Intronic
963979623 3:151522761-151522783 TGGTCTTGTGCCAGTTTTCAAGG - Intergenic
964017709 3:151967429-151967451 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
964061752 3:152533175-152533197 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
965159689 3:165116379-165116401 TTGTCTTTTACCAGTTTTCAAGG - Intergenic
965171949 3:165277001-165277023 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
965318123 3:167216052-167216074 TTGTCTTGTACCAGTTTTCAAGG - Intergenic
965326148 3:167307197-167307219 TCGTCTTGTGCCAGTTTTCAAGG - Intronic
965985309 3:174746004-174746026 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
966340267 3:178917905-178917927 TGGCCTTGTTCCAGTTTTTAGGG - Intergenic
967637770 3:191824239-191824261 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
968358841 3:198132242-198132264 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
968720092 4:2196021-2196043 TTGGGTTGTCCCAGTTTTCATGG - Intronic
969179882 4:5431489-5431511 AGGACTTTTGGAAGTTTTCATGG - Intronic
970107335 4:12599534-12599556 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
970248273 4:14087047-14087069 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
971042210 4:22766430-22766452 TTGATTTTTCCCAGGTTACAAGG + Intergenic
971050765 4:22859785-22859807 TGGAAATGTCCCTGTTTTCAGGG - Intergenic
971285667 4:25287178-25287200 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
971429172 4:26545884-26545906 TTGACTTGTGCCAGTTTTCCAGG + Intergenic
971554652 4:27998511-27998533 TTGACTTGTTCCAGTTCTCAGGG + Intergenic
971577652 4:28296920-28296942 TGTTCTTGTGCCAGTTTTCAAGG - Intergenic
971791396 4:31174285-31174307 TGTCCTTTGCCCAGTTTTAATGG + Intergenic
971894049 4:32567026-32567048 TTAACTTTTCTCAGTTTTCTTGG - Intergenic
972027831 4:34409205-34409227 TTGTCTTATTCCAGTTTTCAAGG + Intergenic
972032676 4:34481088-34481110 GTGCCTTTTCCCATTTTTCATGG + Intergenic
972220936 4:36953400-36953422 TTGTCTTGTCCCAGTTTCCAAGG + Intergenic
972858746 4:43140619-43140641 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
972861411 4:43173465-43173487 TTGACTTGTTCCAGTTCTCAGGG - Intergenic
972892925 4:43582023-43582045 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
973145838 4:46824956-46824978 TTGTCTTTTGCCTGTTTTCAAGG - Intronic
973370297 4:49240876-49240898 TGTCCTTTGCCCATTTTTCATGG + Intergenic
973390731 4:49554549-49554571 TGTCCTTTGCCCATTTTTCATGG - Intergenic
973567918 4:52207051-52207073 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
974104742 4:57456940-57456962 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
974158067 4:58100594-58100616 TTGTCTTTTGCTAGTTTTCAAGG + Intergenic
974222316 4:58991470-58991492 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
974281853 4:59805559-59805581 TGTCCTTTGCCCAGTTTTTAAGG + Intergenic
974454343 4:62106839-62106861 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG + Intergenic
974945883 4:68528586-68528608 TGGACAGTACCCAGCTTTCAAGG - Intergenic
975026390 4:69554180-69554202 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
975765058 4:77658766-77658788 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
975889552 4:79010789-79010811 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
975998649 4:80345062-80345084 TTGTCTTGTGCCAGTTTTCATGG - Intronic
975999531 4:80356902-80356924 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
976045012 4:80935881-80935903 TGTACTTTACCCACTTTTTAAGG - Intronic
976363781 4:84210525-84210547 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
976532133 4:86167802-86167824 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
976630216 4:87228773-87228795 TGGACTTTGACCATTTTTCATGG + Intronic
976979514 4:91209279-91209301 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
977332521 4:95655474-95655496 TTGTCTTTTCCCAGTTTTCAAGG + Intergenic
977520015 4:98070441-98070463 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
977552094 4:98452862-98452884 TTGTCTTGTCCCAGTTCTCAGGG + Intergenic
977696878 4:99975601-99975623 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
977904404 4:102458933-102458955 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
977997370 4:103511160-103511182 TTGTCTTATTCCAGTTTTCAAGG + Intergenic
978060728 4:104334464-104334486 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
978205757 4:106079248-106079270 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
978208562 4:106108683-106108705 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
978625629 4:110681890-110681912 TAAACTTTTCCAAGATTTCAAGG - Intergenic
978952561 4:114578646-114578668 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
979148787 4:117280627-117280649 TTGTCTTTTGCCAGTTTTCAAGG + Intergenic
979152589 4:117339143-117339165 TCATCTTTTGCCAGTTTTCAGGG + Intergenic
979301283 4:119090443-119090465 TTGACTTGTGCCGGTTTTCAAGG + Intergenic
979337979 4:119485616-119485638 TTGCCTTGTGCCAGTTTTCAAGG - Intergenic
979553906 4:122022776-122022798 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
979576358 4:122296007-122296029 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
979591660 4:122487987-122488009 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
980034329 4:127866241-127866263 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
980387587 4:132106433-132106455 TGTACTTTGCCCATTTTTAATGG - Intergenic
980516990 4:133877060-133877082 TTGCCTTTTGCCAGTTTTCCAGG + Intergenic
980595930 4:134953870-134953892 TTGTCTTGTTCCAGTTTTCAGGG + Intergenic
980664179 4:135907025-135907047 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
980665616 4:135929848-135929870 TTGTCTTGTCCTAGTTTTCAAGG - Intergenic
980747019 4:137031378-137031400 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
981154229 4:141414910-141414932 TGGATTTGACCCAGATTTCAAGG + Intergenic
981181236 4:141747991-141748013 TTGTCTTGTTCCAGTTTTCATGG - Intergenic
981198249 4:141945415-141945437 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
981453733 4:144929665-144929687 TTGTCTTCTGCCAGTTTTCAAGG + Intergenic
982372670 4:154650915-154650937 TTGCCTTGTGCCAGTTTTCAAGG - Intronic
982528028 4:156504343-156504365 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
982656234 4:158152925-158152947 TTGTCTTGTTCCAGTTTTCAGGG - Intronic
983131610 4:164026661-164026683 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
983169277 4:164517656-164517678 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
983673213 4:170262003-170262025 TGGGATGTTCCCAGTTTTTATGG + Intergenic
983985667 4:174057279-174057301 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
984038263 4:174695663-174695685 TCGTCTTGTGCCAGTTTTCAAGG - Intronic
984053806 4:174900612-174900634 GGAACTATTCACAGTTTTCAGGG - Intronic
984854348 4:184180934-184180956 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
985367802 4:189251461-189251483 TTGTCTTGTGCCAGTTTTCAGGG - Intergenic
985443637 4:190005417-190005439 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
985928773 5:3038683-3038705 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
986227746 5:5832139-5832161 TGGTATTATCCCAGTTCTCAGGG - Intergenic
986295944 5:6438775-6438797 TGGACTCATTTCAGTTTTCAGGG - Intergenic
986753908 5:10816025-10816047 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
986754238 5:10820028-10820050 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
986979487 5:13430548-13430570 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
987275562 5:16358593-16358615 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
987430239 5:17824152-17824174 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
987635154 5:20529813-20529835 TTGTCTTTTGCCGGTTTTCAAGG - Intronic
987670060 5:20995036-20995058 TTGTCTTTTTCCAGTTCTCAAGG - Intergenic
987704754 5:21447945-21447967 TTGTCTTATTCCAGTTTTCAGGG + Intergenic
987780046 5:22422143-22422165 TTGTCTTATGCCAGTTTTCAAGG + Intronic
987805655 5:22762567-22762589 TGGTCTGATCACAGTTTTCAAGG - Intronic
987888085 5:23837110-23837132 TGTCCTTTGCCCAGTTTTTATGG - Intergenic
987915167 5:24203469-24203491 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
987939360 5:24512928-24512950 TGGGCTTTTCAAAGTTTTCTAGG + Intronic
987976377 5:25020174-25020196 GGGACTTTTCAGAGTTTTCAAGG - Intergenic
988017973 5:25584291-25584313 TATTCTTTTTCCAGTTTTCAGGG + Intergenic
988128811 5:27077168-27077190 TAGTCTTCTGCCAGTTTTCAAGG - Intronic
988294350 5:29335663-29335685 TTGTCTTGTGCCAGTTTTCAGGG - Intergenic
989029259 5:37101173-37101195 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
989256249 5:39368710-39368732 AATACTTTTCCCAGTTTTTAAGG + Intronic
989305788 5:39954084-39954106 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
989792445 5:45421951-45421973 TGCTGTTTTCTCAGTTTTCAAGG - Intronic
990390670 5:55316708-55316730 TTGCCTTGTGCCAGTTTTCAAGG - Intronic
990891420 5:60654693-60654715 TTGTCTTTTTCCAGTTCTCAGGG + Intronic
991014392 5:61915580-61915602 AGGTCTTTTACCAGTTTGCATGG - Intergenic
991138463 5:63211189-63211211 TGGACTTTTCCTAGGTATCAAGG + Intergenic
992306852 5:75449441-75449463 GGGAATTTTCCCATTTCTCAAGG + Intronic
992337857 5:75791789-75791811 TTGATTTGTGCCAGTTTTCAAGG + Intergenic
993228469 5:85201639-85201661 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
993336118 5:86661098-86661120 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
993365199 5:87026763-87026785 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
993365688 5:87031295-87031317 TTGTCTTGTCCCAGTTCTCAGGG + Intergenic
993380375 5:87200012-87200034 TAGACTTTGCCCAGTTTTGATGG + Intergenic
993451544 5:88076942-88076964 TCGTCTTGTGCCAGTTTTCAAGG - Intergenic
994127615 5:96186414-96186436 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
994308118 5:98233010-98233032 TGGTCTTTTCTAAGATTTCAAGG - Intergenic
994351029 5:98746394-98746416 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
994404581 5:99328740-99328762 TGGACAATACCCAGCTTTCAAGG - Intergenic
995634578 5:114171920-114171942 TATAATTATCCCAGTTTTCAGGG + Intergenic
995895741 5:117008338-117008360 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
995959560 5:117823227-117823249 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
996036618 5:118765485-118765507 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
996702256 5:126462079-126462101 TGGACTTGTCCCTGTTGTCAGGG - Intronic
996778174 5:127155613-127155635 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
997116031 5:131126669-131126691 TTGCCTTTTGCCAGCTTTCAAGG + Intergenic
997204718 5:132039769-132039791 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
997324631 5:133009834-133009856 TGGATTTTTCTCAGTCTTCTAGG - Intronic
999556412 5:152747447-152747469 TTGGCTTGTGCCAGTTTTCAAGG + Intergenic
999620877 5:153471998-153472020 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1000737635 5:164925382-164925404 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1001074119 5:168612022-168612044 TGGCATTTGCTCAGTTTTCAAGG + Intergenic
1001878980 5:175226414-175226436 TGGATTTCTCCCAGTTGACAGGG + Intergenic
1002369139 5:178736610-178736632 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1002423599 5:179163259-179163281 TTGTGTTTTCCCAGTTTTGAAGG + Intronic
1002821118 6:725628-725650 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
1003807539 6:9742418-9742440 TTGTCTTGTTCCAGTTTTCAAGG + Intronic
1004337735 6:14779795-14779817 TGGACTTTTCCCCATGCTCAAGG - Intergenic
1004793510 6:19055378-19055400 TTGCCTTGTTCCAGTTTTCAAGG - Intergenic
1004929782 6:20451626-20451648 TTGTCTTTTGCCAGTTTTCAAGG + Intronic
1005042809 6:21614731-21614753 TGGACATTTCACATTTTTGAAGG + Intergenic
1005098933 6:22148148-22148170 AGGAGGTTTCCCAGTTGTCATGG + Intergenic
1005207712 6:23423415-23423437 TTGTCTTATTCCAGTTTTCAAGG - Intergenic
1005211504 6:23470070-23470092 TAGACCTTTTCAAGTTTTCAAGG - Intergenic
1006252787 6:32803718-32803740 TTGTCTTCTGCCAGTTTTCAAGG + Intergenic
1006824950 6:36928083-36928105 TGGACATTTCGCAGTCTCCAGGG - Intronic
1007173868 6:39883296-39883318 TGGACATATCCCAGTTGTAAAGG + Intronic
1007207210 6:40162716-40162738 TGCCCCTTGCCCAGTTTTCAAGG + Intergenic
1007216093 6:40239622-40239644 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1007480776 6:42148457-42148479 TGGACTTTTGTCTGTTTTGAGGG - Intergenic
1007821351 6:44562651-44562673 TGGAGTTTTACCAATTTTCAAGG + Intergenic
1008454146 6:51689419-51689441 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1009198732 6:60718992-60719014 TAGGCTTCTCCCATTTTTCAGGG + Intergenic
1009267380 6:61572893-61572915 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1009316515 6:62227590-62227612 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1009332584 6:62442103-62442125 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1009497539 6:64370094-64370116 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1009753478 6:67903221-67903243 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1009799933 6:68524210-68524232 TTGTCTTGTTCCAGTTTTCAGGG + Intergenic
1010501179 6:76602142-76602164 TTGACTTGTGCCGGTTTTCAAGG - Intergenic
1010556009 6:77280567-77280589 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1010819725 6:80399178-80399200 TTTTCTTTTGCCAGTTTTCAAGG - Intergenic
1010849573 6:80755431-80755453 TTGTCTTCTGCCAGTTTTCAAGG + Intergenic
1011063372 6:83296592-83296614 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1011063617 6:83299667-83299689 TTGACTTGTGCCAGTTTTCAAGG + Intronic
1011214577 6:84991702-84991724 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1011348790 6:86400100-86400122 AGGCCTTTTCCCCGTTTTCTTGG + Intergenic
1011591174 6:88972098-88972120 AGGCCTTTTACCAGTTTGCATGG - Intergenic
1011716797 6:90114591-90114613 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1011916671 6:92514406-92514428 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1011992488 6:93540352-93540374 TTGTCTTTTGCCAGTTTTCAAGG - Intergenic
1012314506 6:97769125-97769147 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
1012348561 6:98222848-98222870 TGGTCTTGTTCCACTTTTCAAGG - Intergenic
1012784237 6:103603033-103603055 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1013309211 6:108878241-108878263 TGGAGTATTCCCAGTTTTGATGG + Intronic
1013393377 6:109710026-109710048 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1013626021 6:111937681-111937703 TAGACTTTTCCTATTTTCCATGG - Intergenic
1013669619 6:112385708-112385730 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1013826707 6:114219933-114219955 TGAACTTTTCAAGGTTTTCATGG - Intronic
1013848375 6:114482856-114482878 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1013919739 6:115389699-115389721 TTGTCTTGTACCAGTTTTCAAGG + Intergenic
1014223165 6:118819186-118819208 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1014224828 6:118835914-118835936 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1014301941 6:119692806-119692828 TTGTCTTATACCAGTTTTCAAGG + Intergenic
1014393201 6:120891079-120891101 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1014414062 6:121162477-121162499 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1014418515 6:121213124-121213146 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1014650110 6:124025841-124025863 TGTACTTTTCTCTGTTGTCAAGG - Intronic
1015193010 6:130492586-130492608 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1015198035 6:130545511-130545533 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1015390774 6:132679156-132679178 TGTCCTTTGCCCAGTTTTAATGG - Intergenic
1015658090 6:135542408-135542430 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1016423367 6:143908843-143908865 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1016498775 6:144693957-144693979 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1017302721 6:152881229-152881251 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1017547193 6:155465196-155465218 TGTACTTTGCCCATTTTTAATGG + Intergenic
1017631973 6:156404933-156404955 TGGACTTTTATCATTTTTCTGGG - Intergenic
1017792577 6:157814402-157814424 GGTACATTTTCCAGTTTTCAAGG - Intronic
1017994163 6:159517308-159517330 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1018661911 6:166095942-166095964 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
1018740504 6:166725121-166725143 TAGACTTTTTCTATTTTTCATGG + Intronic
1018905454 6:168073083-168073105 TGGACTTTTCCCAGTTTTCAGGG - Intronic
1019845957 7:3501757-3501779 TGGACTTTTTCCAGTTATGATGG + Intronic
1020393886 7:7691122-7691144 TGGTCTTTTCACAGTTTGTAGGG + Intronic
1020600308 7:10267084-10267106 TGGACTTTTCCCAGGTGAAAGGG - Intergenic
1020651292 7:10879610-10879632 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1020860543 7:13487509-13487531 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1021135531 7:16960271-16960293 TTGCCTTGTGCCAGTTTTCAGGG + Intergenic
1021154834 7:17197013-17197035 TCGTCTTGTGCCAGTTTTCAAGG - Intergenic
1021293800 7:18878735-18878757 TTGTCTTATGCCAGTTTTCAAGG - Intronic
1021323846 7:19242835-19242857 TGGTCTTTCCCCAGTTTCAATGG + Intergenic
1021350825 7:19592081-19592103 TTGTCTTATTCCAGTTTTCAAGG + Intergenic
1021371754 7:19857656-19857678 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1021427821 7:20522782-20522804 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1021706171 7:23370142-23370164 GGTACTTTACCCAGTTTTGAGGG - Intronic
1021780097 7:24095978-24096000 TTGACTTCTGCCGGTTTTCAAGG + Intergenic
1022367509 7:29738581-29738603 TTGACTTTTCCCTGTTTTGGGGG - Intergenic
1023211688 7:37812491-37812513 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
1023234901 7:38074900-38074922 TTGACTTGTGCCAGATTTCAAGG + Intergenic
1023497308 7:40811831-40811853 TGGTCTTGTTCCAGTTCTCAAGG + Intronic
1023641972 7:42268284-42268306 TGGACTTCTCCCAGACTCCAAGG - Intergenic
1023666892 7:42532541-42532563 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1024456241 7:49610592-49610614 TTGTCTTATACCAGTTTTCAAGG + Intergenic
1024590336 7:50876451-50876473 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
1024655396 7:51447606-51447628 AGGCCTTTTACCAGTTTGCATGG - Intergenic
1024859936 7:53826772-53826794 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1025789424 7:64674667-64674689 TAGTCTTGTGCCAGTTTTCATGG + Intronic
1025802571 7:64800260-64800282 TTGTCTTGTGCCAGTTTTCATGG + Intronic
1025823029 7:64988525-64988547 TTGTCTTGTGCCAGTTTTCATGG - Intronic
1025901972 7:65751704-65751726 AGGACTTTTCCCAGATCTCAGGG - Intergenic
1026116035 7:67496388-67496410 AGGACTTTTCTCCGTTTTCCAGG - Intergenic
1027506603 7:79023409-79023431 TTGTCTTCTTCCAGTTTTCAAGG - Intronic
1027608254 7:80327198-80327220 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1027860437 7:83571648-83571670 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
1027935458 7:84596146-84596168 TGAACTTTTTCCAGTTCTCAAGG - Intergenic
1027939151 7:84650675-84650697 TGGTCTATTTCTAGTTTTCACGG - Intergenic
1028183736 7:87755795-87755817 TTGTCTTATGCCAGTTTTCAAGG - Intronic
1028261999 7:88677887-88677909 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
1028300428 7:89193072-89193094 CTGTCTTTTGCCAGTTTTCAAGG - Intronic
1028402278 7:90436838-90436860 TTGTCTTGTTCCAGTTTTCAGGG - Intronic
1028624890 7:92866663-92866685 TGTTCTTTTGCCAGTTTTGAAGG - Intergenic
1028822995 7:95234105-95234127 TTGTCTTGTTCCAGTTTTCACGG - Intronic
1030009152 7:105148983-105149005 TGGACAATACCCAGCTTTCAAGG - Intronic
1030200587 7:106899429-106899451 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1030439318 7:109566723-109566745 TGAACTTCTCCCTGTTCTCATGG + Intergenic
1030497933 7:110323191-110323213 TGGAATTTTCCCAATTTTTAAGG - Intergenic
1030661434 7:112223449-112223471 GTGACTTTTCCCAGTCTCCATGG + Intronic
1030767753 7:113432754-113432776 TGGATTGTTTCCAGTTTTCAAGG + Intergenic
1030936729 7:115594062-115594084 TGGACATGTCCCATTTTTCCAGG - Intergenic
1031358587 7:120819406-120819428 TGGAGTTTTCCCAGAGTTAAGGG - Intronic
1031637050 7:124114262-124114284 TTGTCTTTTCTCATTTTTCATGG - Intergenic
1031685461 7:124728608-124728630 TGGACTTTTTTCAGTCTTCAAGG - Intergenic
1031703054 7:124948901-124948923 TTGTCTTGTGCCAGTTTTCACGG - Intergenic
1034743524 7:153500830-153500852 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1036247160 8:7127639-7127661 TGGACAATACCCAGCTTTCAAGG + Intergenic
1036253635 8:7186723-7186745 TGGACAATACCCAGCTTTCAAGG - Intergenic
1036363857 8:8100757-8100779 TGGACAATACCCAGCTTTCAAGG + Intergenic
1036887098 8:12566327-12566349 TGGACAATACCCAGCTTTCAAGG - Intergenic
1036894691 8:12624423-12624445 TGGACAATACCCAGCTTTCAAGG - Intergenic
1037320880 8:17641364-17641386 TGGTCTTTTCCCAGTTTCTCTGG + Intronic
1037996250 8:23354425-23354447 TCGACTTTCCCCAGTTTGGAAGG - Intronic
1039264801 8:35813099-35813121 TTGTCTTTTGCCAATTTTCAAGG - Intergenic
1040520264 8:48170478-48170500 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1040540239 8:48347382-48347404 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1040760503 8:50836309-50836331 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1040842285 8:51797248-51797270 TCGTCTTGTGCCAGTTTTCAAGG - Intronic
1041169134 8:55123288-55123310 AGGAATTTACTCAGTTTTCATGG - Intronic
1041207328 8:55512082-55512104 TTGACTTCACCCATTTTTCATGG - Intronic
1041257860 8:55994990-55995012 TCCACTTTTCCCAGTTTTACTGG + Intronic
1041404782 8:57486045-57486067 TTCTCTTTTGCCAGTTTTCAAGG - Intergenic
1041482340 8:58335645-58335667 TGGTCTTGTGCCAGTTTTCAAGG - Intergenic
1041508430 8:58627289-58627311 TTGTCTTGTTCCAGTTTTCAGGG - Intronic
1041611735 8:59858108-59858130 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1041875439 8:62682390-62682412 TGGTCTTTTCCCAGTTCCCCTGG - Intronic
1041889099 8:62848734-62848756 TTGACTTGAGCCAGTTTTCAAGG + Intronic
1041956813 8:63565474-63565496 TGGATTTTTATCAGATTTCAAGG - Intergenic
1042108288 8:65352161-65352183 TTGTCTTTTGCCAGTTTCCAAGG + Intergenic
1042202454 8:66292242-66292264 TTGCTTTTTCCCAATTTTCAGGG + Intergenic
1042371786 8:68000040-68000062 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1042479186 8:69284254-69284276 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1042725213 8:71867977-71867999 TTGTCTCTTCCCAGATTTCAGGG - Intronic
1043283691 8:78502554-78502576 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1043298814 8:78701561-78701583 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1043344833 8:79287048-79287070 CAAACTTTTCCCAGTTTTGAGGG + Intergenic
1043396952 8:79847140-79847162 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1043448082 8:80339095-80339117 TAAACTTTTCTCAGTTTTAAAGG + Intergenic
1043594493 8:81868161-81868183 TTGACATGTTCCAGTTTTCAAGG - Intergenic
1043805301 8:84664892-84664914 TTGTCTTTTGCCAGTTTTCAAGG + Intronic
1044127678 8:88478271-88478293 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1044222216 8:89682434-89682456 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1044564348 8:93647201-93647223 TGGACTTTTCCCAAGTTACTTGG - Intergenic
1044614289 8:94123411-94123433 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1044883772 8:96752694-96752716 TTGTCTTGTACCAGTTTTCAAGG + Intronic
1045410960 8:101918405-101918427 TTGTCTTTTTCCAGTTCTCAAGG - Intronic
1045574875 8:103409720-103409742 TTGACTTTTCCCCCTTTTCCTGG - Intronic
1045590842 8:103594889-103594911 TGAACTGTTCCCAGGTTTCATGG - Intronic
1045728294 8:105201948-105201970 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1046011364 8:108552279-108552301 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1046471626 8:114682545-114682567 TGGCCTTTACCTAGATTTCAAGG - Intergenic
1046668637 8:117033780-117033802 TTGCCTTTTCCCACTTCTCAAGG - Intronic
1046709220 8:117490706-117490728 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1046959777 8:120098411-120098433 TTGTCTTGTTCCAGTTTTCAGGG + Intronic
1046961487 8:120117744-120117766 TGCACTTTTCACAGTTCTAAAGG - Intronic
1047015191 8:120716910-120716932 TGGTCTTTCAGCAGTTTTCATGG + Intronic
1047168975 8:122471516-122471538 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1047676637 8:127209663-127209685 TGGTCTTCTCACAGTTTTCAAGG + Intergenic
1047929852 8:129716684-129716706 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1048715965 8:137270115-137270137 TTGACTTGTGCCAATTTTCAAGG - Intergenic
1049110055 8:140636515-140636537 TCGCCTTTTCCCAGATTTCCCGG + Intergenic
1049652843 8:143782376-143782398 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1049876103 8:145021904-145021926 TGGACGATACCCAGCTTTCAAGG + Intergenic
1049954785 9:682479-682501 TGCATTTTTCCAAGTCTTCATGG + Intronic
1049967551 9:793054-793076 AAGACTTCTCCCAGATTTCAGGG - Intergenic
1050239165 9:3616092-3616114 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1050295543 9:4201257-4201279 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
1050678706 9:8085352-8085374 TGGAAGTGTCCCATTTTTCAAGG + Intergenic
1051110606 9:13631231-13631253 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1051228430 9:14927622-14927644 AGCACTCTTCCCAGTATTCAGGG - Intergenic
1051319956 9:15892268-15892290 TTGACTTGTGCCAGTTGTCAAGG + Intronic
1051458062 9:17283663-17283685 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1051833041 9:21302210-21302232 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1051946497 9:22575529-22575551 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1052094279 9:24365639-24365661 TTGTCTTGTGCCAGTTTTCATGG + Intergenic
1052135937 9:24910017-24910039 CAGACTTTTCTTAGTTTTCATGG - Intergenic
1052371559 9:27671126-27671148 TCGGATTTTCTCAGTTTTCAGGG - Intergenic
1052384963 9:27811701-27811723 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1052707125 9:32007603-32007625 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1053531174 9:38883090-38883112 TTGTCTTGTACCAGTTTTCAAGG - Intergenic
1053558230 9:39160581-39160603 CTGTCTTGTCCCAGTTTTCAAGG - Intronic
1053822347 9:41980818-41980840 CTGTCTTGTCCCAGTTTTCAAGG - Intronic
1054138885 9:61458345-61458367 CTGTCTTGTCCCAGTTTTCAAGG + Intergenic
1054203396 9:62107522-62107544 TTGTCTTGTACCAGTTTTCAAGG - Intergenic
1054373707 9:64432625-64432647 TGTCCTTTTCCCATTTTTAATGG - Intergenic
1054608229 9:67206560-67206582 CTGTCTTGTCCCAGTTTTCAAGG + Intergenic
1054634966 9:67480842-67480864 TTGTCTTGTACCAGTTTTCAAGG + Intergenic
1055225340 9:73988806-73988828 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1055254778 9:74356104-74356126 TGAACTTTTCACAGTCCTCAAGG + Intergenic
1055373005 9:75620419-75620441 TTGGCTTGTGCCAGTTTTCAAGG + Intergenic
1056286934 9:85097422-85097444 TGGAATTTTCCAAATATTCAAGG - Intergenic
1056675230 9:88670915-88670937 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1056885544 9:90440169-90440191 TTGTCTTGTGCCAGTTTTCAGGG + Intergenic
1058087685 9:100766790-100766812 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1058135717 9:101305651-101305673 TGTACTTTTCCCAGTTCTGAAGG + Intronic
1058529993 9:105896498-105896520 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1059077002 9:111204028-111204050 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1059242461 9:112818792-112818814 GGCAGTTTTCTCAGTTTTCAGGG + Intronic
1059351509 9:113668681-113668703 TGTGCTTTTTCTAGTTTTCATGG - Intergenic
1059968411 9:119639134-119639156 TGGACCTTTCCCAGGTTTGAGGG - Intergenic
1060141787 9:121216661-121216683 AGGACTTCTCCCTGTTTTCTTGG + Intronic
1060263314 9:122093808-122093830 GGCACTTTTCCCTGTTCTCAGGG + Intergenic
1060567892 9:124610165-124610187 CGGTCTTTTGTCAGTTTTCAAGG + Intronic
1062148311 9:135003568-135003590 TGTACATTTTCCTGTTTTCAAGG + Intergenic
1202785514 9_KI270719v1_random:13745-13767 TGGACTATTCCTATTTTTCCTGG - Intergenic
1186593598 X:10956995-10957017 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1187006556 X:15238530-15238552 TATACTATCCCCAGTTTTCATGG + Intronic
1187108614 X:16271671-16271693 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
1187620635 X:21049629-21049651 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1187624617 X:21096569-21096591 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1187756146 X:22528999-22529021 TTGTCTTTTGCTAGTTTTCAAGG - Intergenic
1187945485 X:24422622-24422644 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1188139294 X:26528626-26528648 TTGTCTTCTGCCAGTTTTCAAGG - Intergenic
1188164079 X:26839727-26839749 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1188219221 X:27519507-27519529 TGGTCTTTTCCAAGTCTTCCTGG - Intergenic
1188229639 X:27645490-27645512 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1188434414 X:30144321-30144343 TGGAATTTTACAAGTTTTAAAGG - Intergenic
1188454920 X:30353248-30353270 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1188793927 X:34439604-34439626 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1188796840 X:34477575-34477597 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1188814451 X:34694382-34694404 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1188828787 X:34870649-34870671 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1189006462 X:36999942-36999964 AGGCCTTTTACCAGTTTGCATGG - Intergenic
1189678693 X:43491090-43491112 TTGACTTGTACCAGTTTTCAAGG - Intergenic
1189940290 X:46113939-46113961 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1190022035 X:46887607-46887629 CCCACTTTTCCCAGTGTTCAGGG + Exonic
1190585870 X:51941309-51941331 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1190821023 X:53972721-53972743 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1190902584 X:54692571-54692593 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1190960837 X:55245523-55245545 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1191032160 X:55986203-55986225 TTGACTTGTGCCAGTTTTCAAGG + Intergenic
1191037789 X:56045912-56045934 TTGTCTCTTCCCAGTTCTCAGGG + Intergenic
1191099306 X:56707801-56707823 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1191217103 X:57944355-57944377 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1191221736 X:57996745-57996767 TGGTCTTGTGCCAGTTTTCAAGG + Intergenic
1191645563 X:63477643-63477665 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1191685814 X:63889252-63889274 TTGTCTTGTTCCAGTTTTCAAGG - Intergenic
1191766221 X:64701261-64701283 TCGTCTTGTGCCAGTTTTCAAGG + Intergenic
1191812593 X:65205601-65205623 TTGTCTTGTTCCAGTTTTCAGGG - Intergenic
1191817177 X:65258492-65258514 TTGTCTTCTTCCAGTTTTCAAGG - Intergenic
1191933538 X:66401057-66401079 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1191959313 X:66682529-66682551 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1192015777 X:67328793-67328815 TTGTCTTTTTCTAGTTTTCATGG + Intergenic
1192277136 X:69644680-69644702 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1192604438 X:72500698-72500720 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1192717291 X:73657683-73657705 TTGTGTTTTCCCAATTTTCAAGG + Intronic
1192792031 X:74392110-74392132 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1192881472 X:75288762-75288784 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
1192886883 X:75344812-75344834 TTGTCTTTTGCCCGTTTTCAAGG + Intergenic
1192912073 X:75615718-75615740 TTGGCTTGTGCCAGTTTTCAAGG - Intergenic
1192956845 X:76080637-76080659 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1193015434 X:76727368-76727390 CTGTCTTTTGCCAGTTTTCAAGG + Intergenic
1193073219 X:77328740-77328762 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1193094499 X:77531706-77531728 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1193160224 X:78219700-78219722 TTGTCTTGTTCCAGTTTTCACGG + Intergenic
1193209700 X:78791944-78791966 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1193259101 X:79384129-79384151 TTGTCTTTTCCCAGTTTTCAAGG - Intergenic
1193261168 X:79407887-79407909 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1193294193 X:79815056-79815078 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1193408322 X:81131788-81131810 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1193436599 X:81481358-81481380 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
1193471066 X:81904462-81904484 TTGTCTTGTCCCAGTTCTCAGGG + Intergenic
1193528421 X:82622684-82622706 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1193663154 X:84281521-84281543 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1193788761 X:85793242-85793264 TTGTGTTTTACCAGTTTTCAAGG + Intergenic
1193805462 X:85988427-85988449 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1193858454 X:86635454-86635476 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1193859277 X:86644039-86644061 TTGTCTTGTTCCAGTTTTCAAGG - Intronic
1193954364 X:87840889-87840911 TTGTCTTTTTCCAGTTTTCTGGG + Intergenic
1193975426 X:88112652-88112674 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1194096378 X:89644799-89644821 TGGAATTTGCCCATTTTTAATGG - Intergenic
1194124861 X:90004006-90004028 TTGTCTTTTCCTAGTTTTTAGGG + Intergenic
1194180223 X:90702292-90702314 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1194194282 X:90872071-90872093 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1194219206 X:91170613-91170635 TGGACAATACCCAGCTTTCAAGG - Intergenic
1194324859 X:92501795-92501817 TTGCCTTGTGCCAGTTTTCAAGG - Intronic
1194365073 X:93004840-93004862 TTGTCTTTTGCCAGTTTTCAAGG + Intergenic
1194406157 X:93498206-93498228 TTGTCTTCTGCCAGTTTTCAAGG - Intergenic
1194517831 X:94878741-94878763 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1194805468 X:98321601-98321623 TTGTCTTGTCCTAGTTTTCAAGG + Intergenic
1194830285 X:98615336-98615358 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1194874980 X:99175593-99175615 TTGTCTTTTCCCAGCTTTCAAGG - Intergenic
1194902348 X:99528460-99528482 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1194962702 X:100254124-100254146 TTGTCTTATGCCAGTTTTCAAGG - Intergenic
1195024160 X:100858998-100859020 TTGTCTTTTTCCAGTTTTCAAGG + Intronic
1195173531 X:102292914-102292936 TGGAATTTTCCCCGTGTTCCTGG + Intergenic
1195185334 X:102394182-102394204 TGGAATTTTCCCCGTGTTCCTGG - Intronic
1195207798 X:102620984-102621006 TTGCCTTGTGCCAGTTTTCAAGG + Intergenic
1195443262 X:104921565-104921587 TGGCCTTGTCCCAGTTTCCCAGG + Intronic
1195473106 X:105255720-105255742 TTGTCTTGTGCCAGTTTTCAAGG + Intronic
1195818338 X:108913587-108913609 TTGTCTTTTTCCAGTTCTCATGG - Intergenic
1195838607 X:109147690-109147712 TTGTCTTATTCCAGTTTTCAAGG - Intergenic
1196019461 X:110975034-110975056 TTGCCTTGTGCCAGTTTTCAAGG - Intronic
1196225501 X:113160971-113160993 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1196293188 X:113967689-113967711 TGGTCTTTTCACATTTTTGATGG + Intergenic
1196536654 X:116853257-116853279 TTGTCTTATGCCAGTTTTCAAGG + Intergenic
1196559566 X:117129028-117129050 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1196926416 X:120637696-120637718 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1197031796 X:121825124-121825146 TTGTCTTTTTCCAGTTCTCAAGG - Intergenic
1197040076 X:121926391-121926413 TTGACTTGTGCCAGTTTTCAAGG - Intergenic
1197076497 X:122359823-122359845 TTGTCTTCTGCCAGTTTTCAAGG + Intergenic
1197180532 X:123531086-123531108 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1197279180 X:124515273-124515295 TTGTCTTGTGCCAGTTTTCAAGG - Intronic
1197456014 X:126676170-126676192 TTGTCTCTTGCCAGTTTTCAAGG - Intergenic
1197509529 X:127354268-127354290 TGGACAATACCCAGCTTTCAAGG - Intergenic
1197532914 X:127652694-127652716 TTGCCTTTTGCCAGTTTTCAAGG - Intergenic
1197564282 X:128062466-128062488 TTGTCTTCTGCCAGTTTTCAAGG - Intergenic
1197642478 X:128982113-128982135 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1197956813 X:131959735-131959757 TGGTCTTGTTCCAGTTCTCAGGG - Intergenic
1198569285 X:137938106-137938128 AGGCCTTTTCCCTGTTTTCTTGG + Intergenic
1198769660 X:140116277-140116299 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1199001516 X:142643511-142643533 TTGTCTTTTTCCAGTTTTCAGGG + Intergenic
1199120828 X:144051773-144051795 TTGACTTGTGCCAGCTTTCAAGG - Intergenic
1199369625 X:147032092-147032114 TGTTCTTTTCCCAGGTTTCTTGG - Intergenic
1199468360 X:148165743-148165765 TGGCCTGGTCCCAGTGTTCAGGG - Intergenic
1199589015 X:149448542-149448564 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1199706748 X:150433475-150433497 TTGTCTTGTCCCAGTTTTCAAGG + Intronic
1199797708 X:151217135-151217157 TTGATTTTTCACAGTTTTTATGG + Intergenic
1200427996 Y:3043058-3043080 TGGACTTTGCCCAGTGCACATGG + Intergenic
1200431336 Y:3086519-3086541 TTGTCTTGTTCCAGTTTTCAAGG + Intergenic
1200449385 Y:3306174-3306196 TGGAATTTGCCCATTTTTAATGG - Intergenic
1200477751 Y:3661615-3661637 TTGTCTTTTCCTAGTTTTTAAGG + Intergenic
1200526883 Y:4284452-4284474 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1200540893 Y:4454462-4454484 TTGTCTTGTGCCAGTTTTCAAGG - Intergenic
1200555724 Y:4634370-4634392 TGGACAATACCCAGCTTTCAAGG - Intergenic
1200564273 Y:4745182-4745204 TTGTCTTTTTCCAGTTCTCAAGG - Intergenic
1200633590 Y:5620971-5620993 TTGCCTTGTGCCAGTTTTCAAGG - Intronic
1200673301 Y:6121100-6121122 TTGTCTTTTGCCAGTTTTCAAGG + Intergenic
1200752468 Y:6959058-6959080 TGGACAATACCCAGCTTTCAAGG + Intronic
1200892389 Y:8337790-8337812 AGGACTTTTCCCATGCTTCAGGG + Intergenic
1200900723 Y:8429225-8429247 AGGACTTTTGCCATATTTCAGGG - Intergenic
1201019056 Y:9635434-9635456 CTGTCTTTTGCCAGTTTTCAAGG - Intergenic
1201967033 Y:19749594-19749616 TTGTCTTGTGCCAGTTTTCAAGG + Intergenic
1202096625 Y:21257263-21257285 TGTCCTTTTCCCATTTTTAATGG + Intergenic