ID: 1018906991

View in Genome Browser
Species Human (GRCh38)
Location 6:168081230-168081252
Sequence CCCCTCAGTGCCCTGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018906991 Original CRISPR CCCCTCAGTGCCCTGGCGGG AGG (reversed) Intronic
900100393 1:959953-959975 CCCCTCAGCGCCAGGGCTGGGGG - Intergenic
900338346 1:2175729-2175751 CTCCTCGGGGCCCTGGAGGGTGG - Intronic
900624303 1:3601066-3601088 GCCCCCAGTGCCCTGCCAGGAGG + Intronic
901205522 1:7493627-7493649 CCCCCCAGTTCCCTGGGGGATGG - Intronic
901453503 1:9350476-9350498 CCAGGCAGTGCCCTGGCCGGCGG - Intronic
901814279 1:11785064-11785086 CCCCCCAGTGCCCTGCGGGAGGG - Intronic
902151044 1:14443564-14443586 CCCATCAGAGCCCTGGAGAGTGG - Intergenic
902813840 1:18904804-18904826 CCCCCCAGGGCCCTGGGGGGAGG - Exonic
903180620 1:21603221-21603243 TCCCACAGAGCCCTGGGGGGCGG - Intronic
903472726 1:23598630-23598652 ACCCTCTGTGCCCAGGTGGGTGG - Intronic
903949997 1:26991190-26991212 CCCCTCATTGCCATGGTGGTGGG - Intergenic
904409880 1:30319061-30319083 CCCCTGAGTGACCTGGGAGGAGG + Intergenic
905208128 1:36354663-36354685 CCCCTCAGGGCAGTGGCTGGTGG + Intronic
905569314 1:38991369-38991391 CCCCTCAGCGGCATGGCGTGCGG + Exonic
905627376 1:39497924-39497946 CCCCACAGGGCCCTGCCTGGAGG + Intronic
905669053 1:39779187-39779209 CCCCACAGGGCCCTGCCTGGAGG - Intronic
910371791 1:86524061-86524083 CCCCTCACTGCCCGGGCCTGTGG + Intergenic
910693138 1:89984870-89984892 CCCCTCACTGCCCGGGCCGGTGG + Intergenic
911450486 1:98054401-98054423 CCCTCCAGTGCCCTGGCGCTGGG + Intergenic
912824684 1:112894797-112894819 CCCCTCACTGCCGGGGCCGGCGG - Intergenic
913703546 1:121396909-121396931 GCCCTCAGAGCCGTGGCGGCGGG - Intergenic
913979897 1:143498620-143498642 GCCCTCAGAGCCGTGGCGGCGGG - Intergenic
914074246 1:144324104-144324126 GCCCTCAGAGCCGTGGCGGCGGG - Intergenic
914104930 1:144642342-144642364 GCCCTCAGAGCCGTGGCGGCGGG + Intergenic
915366692 1:155320914-155320936 CCGCTCTGTGCCCCGCCGGGCGG + Exonic
916127993 1:161588493-161588515 CCTCCCAGTGCCCTGTCTGGAGG + Intronic
916137911 1:161670323-161670345 CCTCCCAGTGCCCTGTCTGGAGG + Intronic
917185850 1:172354448-172354470 CCTCTCAGTGCTCAGGCTGGTGG + Intronic
919712185 1:200739301-200739323 CCCCTCAGGCCCCGGGTGGGCGG - Intergenic
920878468 1:209858903-209858925 CCCCTCACTGCCCGGGGCGGCGG + Intergenic
920965497 1:210697654-210697676 CCACTCATTGCCATGGCGGGTGG + Intronic
922335815 1:224617422-224617444 GCCTTCGGTGCCCTGGCTGGAGG + Intronic
922703998 1:227779373-227779395 CCGCCCAGTGACATGGCGGGAGG - Intronic
922724643 1:227917272-227917294 GGCCTCTGTGCCCAGGCGGGAGG - Intergenic
923172600 1:231431026-231431048 CCCCTCACTGCCCAGGCCGGCGG + Intergenic
1063565634 10:7170694-7170716 CCCACCAGTGCCATGGTGGGGGG - Intronic
1063951502 10:11227331-11227353 CCTCTCAGTGCCCTGGTTTGTGG - Intronic
1065752171 10:28897029-28897051 CCCCTCACTGCCCGGGCCGGTGG + Intergenic
1066627244 10:37419228-37419250 CTCCTCTGTGCCCTGGTGAGAGG + Intergenic
1069090820 10:64197026-64197048 CCCCTCACTGCCCGGGCCGGTGG + Intergenic
1070794120 10:79207147-79207169 CCCCTCCCTGCCCTGGCGCTGGG + Intronic
1070973377 10:80585984-80586006 CCCCTCATTGCCCGGGCTGGCGG - Intronic
1072607910 10:96999417-96999439 CCCCTCACTGCCCTGGGCAGGGG + Exonic
1073114209 10:101081953-101081975 CCCCTCAGTGCCTTGCCTTGAGG - Intergenic
1075307628 10:121382270-121382292 CCCCTCACTGCCCGGGCCGGTGG - Intergenic
1075635479 10:124027550-124027572 TCACACAGAGCCCTGGCGGGAGG - Intronic
1075686695 10:124369331-124369353 CCCCTCACTGCCCTGGGAAGTGG - Intergenic
1076135222 10:128040924-128040946 CCCCTGAGAGCCCTGGCGAGCGG - Exonic
1076363447 10:129906457-129906479 CCCCTCTCTGCACTGGCAGGGGG + Intronic
1077069886 11:664342-664364 CCTCTCAGTGCCATGGCTTGGGG - Intronic
1077215014 11:1391576-1391598 CCCTTCCGTGCCGTGGCGGGTGG - Intronic
1077406983 11:2387099-2387121 CCCCTCAGCGCCCAGGCTAGAGG + Intronic
1077438131 11:2554518-2554540 CTCCTCAGTGCCCTGAGAGGGGG + Intronic
1077466402 11:2735680-2735702 CCCCTCACAGCCCTGGAGGCTGG + Intronic
1078011594 11:7576696-7576718 CCCCAGGGTGCCCTGGCTGGTGG + Intronic
1079111474 11:17607627-17607649 ACCCTCACTGCCCTGGCGGCTGG - Intronic
1080204414 11:29712754-29712776 CCCCTCACTGCCCGGGCTGGTGG - Intergenic
1081374716 11:42344585-42344607 CCCCTCACTGCCCGGGCTGGTGG + Intergenic
1083611471 11:64006422-64006444 CCTCTCGGTGCCAAGGCGGGTGG + Intronic
1083690398 11:64404835-64404857 CTCCTAAGTGCCCTGGCAGAAGG - Intergenic
1083912942 11:65720585-65720607 ACCCTCGGGGCCCTGGCGGATGG + Exonic
1084592603 11:70099176-70099198 CTCCTCAGGGCGCTGGCTGGGGG + Intronic
1089695133 11:120211931-120211953 CCCCTCAGTGCCCTGTACAGGGG - Intronic
1091597312 12:1886760-1886782 CAGCTCAGTGTCCTGGCAGGAGG + Intronic
1092834215 12:12472641-12472663 CCCCTCACTGCTCGGGCGGTGGG + Intergenic
1093175749 12:15911489-15911511 CCGCCCAGTGCCCTGGCTGTGGG + Intronic
1095304151 12:40620764-40620786 CCCCTCACTGCCCCGGCCGGTGG - Intergenic
1097212939 12:57386420-57386442 CCCCTCACTGCCCTGGTGGGCGG - Intronic
1097863834 12:64543241-64543263 CCCCTCACTGCCTGGGCGGGCGG - Intergenic
1101603838 12:106233119-106233141 CCCCTCACTGCCCAGGCCGCCGG - Intergenic
1103275490 12:119708149-119708171 CCCCTCAGAGTCCTAGCTGGTGG - Intronic
1103459669 12:121093760-121093782 CCCCTCACTGCCCGGGGCGGCGG + Intergenic
1103904640 12:124321098-124321120 CCACTCTGTGCCCTGGGTGGAGG + Intergenic
1104003451 12:124875292-124875314 CCCCTCATTTCCCTGTCTGGAGG - Intronic
1105289994 13:19047580-19047602 CCCCTCAGGGCCGTGGCAGCTGG - Intergenic
1105697226 13:22900661-22900683 CCCCTCACTGCCCCGGCCAGCGG + Intergenic
1105777642 13:23678064-23678086 CCCCTCACTGCTCAGGCCGGCGG + Intergenic
1105847727 13:24307983-24308005 CCCGGCAGGGTCCTGGCGGGAGG + Intronic
1109741526 13:66561172-66561194 CCCCTCACTGCCCCGGTGGCGGG - Intronic
1109829965 13:67773188-67773210 CCCCTCACTGCCTGGGCGGCCGG + Intergenic
1109854306 13:68107969-68107991 CCCCTCACTGCCCGGGCCGGCGG + Intergenic
1113594450 13:111521240-111521262 CCCCTGCGTGCCCTGTGGGGTGG + Intergenic
1113766276 13:112882731-112882753 CGGCTCCGTGCCCTGGCGAGTGG - Exonic
1113825326 13:113248003-113248025 CCCATCAGGATCCTGGCGGGAGG + Intronic
1113876434 13:113597587-113597609 TCCCTCACTGCCCTGTAGGGAGG - Intronic
1114155541 14:20099306-20099328 CCCCTCACTGCCCGGGGCGGCGG - Intergenic
1114266303 14:21074545-21074567 CCCTCCAGCGCCCTTGCGGGTGG - Exonic
1114522145 14:23346621-23346643 CCTCTGAGTACCCTGGCGGGAGG - Exonic
1114957742 14:27845467-27845489 CCCCTCACTGCCCGGGGCGGTGG - Intergenic
1116152133 14:41154492-41154514 CCCCTCACTGCCCGGGCCGGCGG + Intergenic
1116297917 14:43136179-43136201 CCCCTCACTGCCCGGGCCGGTGG + Intergenic
1117183659 14:53217763-53217785 CCCCTCACTGCCCGGGCCGGCGG + Intergenic
1118843640 14:69529863-69529885 CCCTTCAGCCCCCTGGAGGGTGG - Exonic
1119725249 14:76918359-76918381 CCCCTCCCTCCCCTGGCGGGAGG + Intergenic
1122226815 14:100285331-100285353 CCCCACGCTGCTCTGGCGGGCGG + Intergenic
1122267899 14:100555183-100555205 CCCCAGACGGCCCTGGCGGGGGG - Intronic
1122434973 14:101689188-101689210 CCCCTCACTGCCCAGGCAGGTGG - Intergenic
1122534384 14:102451981-102452003 CAACTCGGTGCCCTGGAGGGAGG - Intronic
1122599098 14:102912462-102912484 CCCTGCCGTGCCCTGGCTGGTGG + Intergenic
1122715351 14:103693677-103693699 CCCCTCACCGCCCTGCCCGGAGG + Intergenic
1122929549 14:104927067-104927089 CCCCTCAGTGCCTGGGCAGCTGG - Intronic
1122997469 14:105273162-105273184 CACCTCAGAGCCCTGGAGAGAGG - Intronic
1123020175 14:105394321-105394343 ACACTCAGAGCCCTGGGGGGTGG - Intronic
1123075264 14:105664769-105664791 GCCCTCAGTGCCCTGAGGGGTGG - Intergenic
1123089912 14:105737905-105737927 GGCCTCAGTGCCCTGAGGGGTGG - Intergenic
1123393221 15:19899168-19899190 CCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1123493271 15:20799598-20799620 CCCCTCAGCGCCCTGGACTGTGG + Intergenic
1123549778 15:21368700-21368722 CCCCTCAGCGCCCTGGACTGTGG + Intergenic
1124343474 15:28904922-28904944 CCCCTCAGTGTGCTGGTGAGTGG - Intronic
1124387852 15:29225001-29225023 CCCCTCACTGCCCGGGCCGGCGG + Intronic
1124632227 15:31344467-31344489 CTCCTCAGTGCCTTGGCTGGTGG + Intronic
1125914560 15:43474128-43474150 CCCCTCATTGCCCGGGGGGCCGG + Intronic
1126165538 15:45651257-45651279 CCCCTCACTGCCCGGGCCTGTGG + Intronic
1126874303 15:53023051-53023073 GCCCTCAGAGTCATGGCGGGAGG - Intergenic
1129374011 15:75116205-75116227 CCCCTCACTGCCCGGGGCGGTGG + Intronic
1129431771 15:75504700-75504722 CCCCTCACCTCCCGGGCGGGGGG - Intronic
1129986895 15:79926220-79926242 CCCCTCATTGCCCGGCCGGCAGG - Intergenic
1131096198 15:89655520-89655542 CCCCCGAGCGCCCCGGCGGGCGG - Intergenic
1131097146 15:89663342-89663364 CCCAGCAGTTCCCTGGGGGGTGG - Intergenic
1131113091 15:89777224-89777246 CCCACCAGTGCCCTGGACGGCGG + Exonic
1131152152 15:90053913-90053935 CCCCACAGTGGCCAGGAGGGAGG - Intronic
1131212688 15:90511067-90511089 CCCCTCACTGCCCGGGGCGGTGG - Intergenic
1131553388 15:93376839-93376861 ACACCCAGTGCCTTGGCGGGTGG + Intergenic
1131655810 15:94457537-94457559 CCCCACAGTGCACTGCTGGGAGG - Intronic
1132204094 15:99974706-99974728 ACCCCCAGTGCCCTGGCAGGAGG - Intronic
1202958109 15_KI270727v1_random:95918-95940 CCCCTCAGCGCCCTGGACTGTGG + Intergenic
1132656146 16:1042795-1042817 CCCCACAGTGCTCTGGCTCGAGG - Intergenic
1132699199 16:1215116-1215138 CCCCTCAGGGCTCTGGGGGCTGG + Intronic
1132801378 16:1756053-1756075 CCCCACCGAGCACTGGCGGGTGG + Intronic
1133132486 16:3685968-3685990 TCCCTCAGTGTCCAGGCGTGTGG - Intronic
1133225061 16:4337087-4337109 GACCTCAGTGCCCTGGCCTGTGG + Exonic
1133419116 16:5630566-5630588 ACCTTCAGAGCACTGGCGGGTGG + Intergenic
1134678143 16:16104879-16104901 CCCCTCACTACCCGGGCTGGCGG + Intronic
1136059745 16:27718371-27718393 CCCCTCGGTGCCAGGGCAGGAGG - Intronic
1136519610 16:30787083-30787105 CCCTTCAGTGCCCTGCCTCGGGG + Exonic
1137354311 16:47744697-47744719 CCTCTTAGTGCTCAGGCGGGTGG + Intergenic
1138660243 16:58512317-58512339 CCCCACAGTGACCTGACTGGGGG + Exonic
1138717545 16:59041600-59041622 CCCCTGAGAGCCCTGACGGTAGG - Intergenic
1139380741 16:66529211-66529233 CTCCTCACTCCCCTGCCGGGAGG + Intronic
1139483963 16:67246116-67246138 CGCCTCTGAGCGCTGGCGGGAGG - Intronic
1140892459 16:79296884-79296906 GCTCTCAATGCCCTGGTGGGTGG + Intergenic
1141531351 16:84648772-84648794 CCCCTTGGTGCCGGGGCGGGCGG + Intronic
1141660572 16:85439092-85439114 CCCCTGACAGCCCTGGCTGGGGG - Intergenic
1141965028 16:87436321-87436343 CCCGGAGGTGCCCTGGCGGGGGG - Intronic
1142828813 17:2532345-2532367 CCCCTCACTGCCCGGGCTGGCGG + Intergenic
1143127990 17:4656761-4656783 CCCCTCACTGCCCGGGCCGGGGG + Intergenic
1143991615 17:10968405-10968427 ACCCTCAGGGCCCTGGCAGTGGG + Intergenic
1144128082 17:12221013-12221035 GCCCTCACTGCCCGGGCCGGCGG - Intergenic
1144850645 17:18242312-18242334 CCCCACGGTGCCCTGGGGGAGGG + Intronic
1145289556 17:21532450-21532472 CCTCTCAGTGCCCTGGAGGCAGG - Exonic
1145694523 17:26775729-26775751 GCCCTCAGTGCCGCGGCGGCGGG - Intergenic
1145998061 17:29115686-29115708 CTCCTCGGGGCCCTGGCGGAAGG + Exonic
1146267604 17:31463375-31463397 TCCCGCAGTGCCCTGGCGTGTGG + Intronic
1146413675 17:32611804-32611826 CGCTTCAGTGCCCAGGCTGGAGG - Intronic
1147179229 17:38674250-38674272 CCCCCCTGCGCCCTGGCGGCTGG - Exonic
1147188437 17:38725415-38725437 CCCCTCAGAGCCCAGGCCAGAGG + Intronic
1147754939 17:42761674-42761696 CGCCTCAGTGCCGGGGAGGGAGG - Intronic
1148333399 17:46825387-46825409 GCCCTCAGAGCCCAGGCGGAAGG - Intronic
1148580348 17:48739070-48739092 CCGCTTAGTGCGTTGGCGGGTGG + Intergenic
1148934745 17:51155916-51155938 CTCCTCAGTGCCCTAGCGTTTGG + Intronic
1149512076 17:57250929-57250951 CCCCCCAGGGCCCTGGCTAGAGG + Intergenic
1149610328 17:57954787-57954809 CCCCGCAGTGCCCGGGCCTGGGG - Intronic
1152218658 17:79048932-79048954 CACCCCAGAGCCCTGGGGGGTGG + Exonic
1152332479 17:79681147-79681169 CCCCTCTGGGCCCAGGCGAGCGG - Intergenic
1152762244 17:82114928-82114950 CCCCACACTGCCATGGAGGGCGG + Intronic
1153500728 18:5746792-5746814 CACCACAGTTCCCTGGTGGGTGG - Intergenic
1154047151 18:10916535-10916557 CCCCTCACTGCCAGGGCGTGCGG + Intronic
1154450826 18:14474136-14474158 CCCCTCAGCGCCCTGGACTGTGG + Intergenic
1158460736 18:57643866-57643888 CCCCTCACTGCCCGGGCTGGCGG + Intergenic
1160512740 18:79461587-79461609 CACGTCAGAGCCCTGGCGGCCGG + Intronic
1160763424 19:797021-797043 GCCCTCACGGCCCAGGCGGGCGG + Intergenic
1160879597 19:1313404-1313426 CCCCTCGGTGCCCGGGGCGGGGG - Intergenic
1160901242 19:1429738-1429760 CTCCTCTGTGCCCTGCCAGGTGG - Intronic
1161313192 19:3606369-3606391 CCCCTGTGTGGCCCGGCGGGTGG - Intronic
1161976548 19:7610880-7610902 GGCCTCAGTGCCCCGGGGGGAGG - Exonic
1162104939 19:8364554-8364576 CCCCTCGGTTCCCTGACAGGCGG - Exonic
1162140178 19:8580733-8580755 CCCTGCAGGGCCCTGGCTGGGGG - Exonic
1162857570 19:13481084-13481106 CCTTTCAGTGCCCTGAGGGGTGG - Intronic
1163233484 19:16018657-16018679 TCCCACTGTGCCCTGGTGGGAGG + Intergenic
1164722398 19:30441904-30441926 CCACGCAGTCTCCTGGCGGGAGG + Intronic
1164940817 19:32251279-32251301 AGGCTCAGTGCCCTGGAGGGTGG + Intergenic
1166203867 19:41256339-41256361 CCCCTCACTGTCCTGGCTGCGGG - Intronic
1167685408 19:50952846-50952868 CCCCTCCTTGCCCTGTCTGGAGG - Exonic
1202680247 1_KI270712v1_random:2851-2873 GCCCTCAGAGCCGTGGCGGCGGG + Intergenic
924977487 2:191609-191631 CCCCTCACTGCCCGGGCTGGCGG + Intergenic
926062615 2:9813685-9813707 CCCCTGGGTGCCGTGGCGAGTGG + Intergenic
926437677 2:12854323-12854345 CCCCTCACTGCCTGGGCTGGCGG + Intergenic
927154063 2:20211814-20211836 CGCCTCAGTGCCCTGCAGTGTGG + Intronic
928158170 2:28895094-28895116 TCCCTCACTGCCCTCGCGGCAGG - Intronic
932621111 2:73265403-73265425 CCCCTCAGTGCTGTGTCGGCGGG + Exonic
932731632 2:74226020-74226042 CCCCTGAGGGCACTGGGGGGAGG + Intronic
933285479 2:80380414-80380436 CTCCTCAGAGCCCTTGCGGGAGG - Intronic
933491062 2:82985959-82985981 GCCCTCACTGCCTGGGCGGGGGG + Intergenic
933531627 2:83518280-83518302 CCCCTCACTGCCCAGGCAGGCGG - Intergenic
933977992 2:87527460-87527482 CCTCACACAGCCCTGGCGGGAGG - Intergenic
934688113 2:96336100-96336122 CTCCTCAGTTCCCGGGCGGGCGG + Intronic
936315840 2:111423347-111423369 CCTCACACAGCCCTGGCGGGAGG + Intergenic
937310735 2:120901522-120901544 CTCCCCAGTGGCCTGGCTGGGGG - Intronic
939738786 2:145881152-145881174 CCCCTCATTCCCCGGGCCGGCGG + Intergenic
942507038 2:176654050-176654072 CCCCTCAGTCCACTAGAGGGTGG - Intergenic
943106164 2:183546898-183546920 CCCCTCAGTGCCCGGGGTGGCGG + Intergenic
945042311 2:205752468-205752490 CTCCCCAGTGCCCTGGTGGAAGG - Intronic
946546710 2:220751926-220751948 TGCCTGATTGCCCTGGCGGGCGG - Intergenic
947549485 2:231036484-231036506 CCCCTCAGTGCCATAGAAGGGGG - Intergenic
948301670 2:236912300-236912322 CCCCTGAGTGCCCTGGATGATGG + Intergenic
948319851 2:237060633-237060655 CCTCTCAGTGCCCTGGGGTGGGG + Intergenic
948864885 2:240770206-240770228 CCCCTCAGTCTCCAGGCGTGTGG + Intronic
1168757627 20:327318-327340 CCCCTCCCTTCCCTGGGGGGAGG + Exonic
1168840060 20:904203-904225 TCCCTCAGTGGCCTGTAGGGAGG - Intronic
1169488517 20:6052879-6052901 CTCCTCAGAGCCCTGGAGGTAGG - Intronic
1169645354 20:7803769-7803791 CCCCTCACTGCCCGGGCCGGCGG + Intergenic
1171078825 20:22156755-22156777 CCCCACAGTTCCTTGGAGGGTGG + Intergenic
1171420038 20:25011896-25011918 CCCAGCAGTGCCCTGGCATGGGG + Intronic
1172096869 20:32464595-32464617 CCCCTCAGTGCCCGGGCAGTGGG + Intronic
1172149001 20:32777572-32777594 CCCCAAAGTGCTCTGGGGGGAGG - Intronic
1174400309 20:50272349-50272371 CCCCTCCGTGCCCTAGGGAGGGG + Intergenic
1175159035 20:56994369-56994391 TCCCTCAGGGCCCTGGGTGGAGG - Intergenic
1175841079 20:62027895-62027917 CCTCTCAGTTCCCTGCTGGGTGG + Intronic
1175957496 20:62618810-62618832 CCCCTCAGAGCCCCGGGGAGGGG - Intergenic
1176179626 20:63743151-63743173 CCCCTCCCCGACCTGGCGGGGGG - Exonic
1176445406 21:6816438-6816460 CCCCTCAGCGCCCTGGACTGTGG - Intergenic
1176823574 21:13681471-13681493 CCCCTCAGCGCCCTGGACTGTGG - Intergenic
1179609025 21:42537096-42537118 CCGCTCAGAGCCCTGGTGGGTGG + Intronic
1179904162 21:44413614-44413636 CCTGGCAGTGCCCTGGTGGGTGG + Intronic
1180224167 21:46379828-46379850 GCCCTCAGGGCTCTGGCGGGCGG + Intronic
1180953844 22:19732606-19732628 GCCCTCAGTACCCTGGGGGGTGG - Intergenic
1181013535 22:20055775-20055797 CCCCTCAGGTGCCTGGCAGGCGG - Intronic
1181863095 22:25834460-25834482 CCCCTCAGAGGCCTGGAGAGGGG - Intronic
1182297511 22:29318475-29318497 CCACTCAGCCCCCTGTCGGGAGG + Intronic
1182639359 22:31754119-31754141 GCCCTCAGTGCCCCGGCCAGAGG + Intronic
1183718082 22:39545926-39545948 CCTCTCCGTGCCCTGGAAGGTGG - Intergenic
1184482358 22:44755273-44755295 CACCTCAGTGCCCAGGGAGGTGG - Intronic
1184695337 22:46135751-46135773 CCCCTCAGAGCCCTGGGGAAGGG + Intergenic
1184728191 22:46358149-46358171 ACCCTCAGTTCCCAGGCTGGAGG - Intergenic
1184921103 22:47606455-47606477 CCCCTGAGTGCCCGGGCCAGCGG + Intergenic
1184921118 22:47606510-47606532 CCCCTGAGTGCCCAGGCCAGTGG + Intergenic
1185029271 22:48433125-48433147 ACCCTCTGTGCCCTGGCAGGAGG - Intergenic
950425198 3:12921312-12921334 AACCCCAGGGCCCTGGCGGGAGG - Intronic
950754675 3:15162769-15162791 CACCTCCCTGCCCGGGCGGGGGG + Intergenic
953568287 3:44051592-44051614 CCACTGTGTGGCCTGGCGGGAGG + Intergenic
953743356 3:45555421-45555443 CTCCTCAGGGCACTGGAGGGCGG - Intronic
954226201 3:49182874-49182896 CCCCTCACTGCCCGGGGCGGGGG + Intronic
956195740 3:66651679-66651701 CCCCTCACTGCCCGGGCCGGTGG - Intergenic
956407914 3:68948209-68948231 CCTCTCAGTTCCCTGGAGAGGGG - Intergenic
957386440 3:79502362-79502384 CCCCTCACTGCCCGGGCGGCGGG - Intronic
957630939 3:82715437-82715459 CCCCTCATTGCCCGGGCGGCAGG - Intergenic
961458490 3:127035969-127035991 CCCCTCAGTGGGCTGGGGGCAGG - Exonic
961866723 3:129958786-129958808 CCCCACAGTGCTCTGTCTGGAGG - Intergenic
962351493 3:134659794-134659816 ACCCCCAGGGGCCTGGCGGGAGG + Intronic
962575442 3:136751873-136751895 CGCCGTAGTGCCCGGGCGGGCGG + Intronic
962998132 3:140651532-140651554 CCCCTCACTGCCTGGGCCGGCGG - Intergenic
963554657 3:146772454-146772476 CCCCTCACTGCCCAGGGCGGTGG - Intergenic
964802892 3:160574196-160574218 CCCCTCACTGCCAGGGCCGGTGG + Intergenic
966096799 3:176213671-176213693 CCCCTCATTGCCCGGGGCGGCGG + Intergenic
966863143 3:184241695-184241717 CCCCTCAGAGCCCGAGCTGGGGG - Exonic
967896014 3:194396880-194396902 CCGCTCTGGGCCCTGCCGGGGGG - Exonic
968199540 3:196740216-196740238 CTTCTCCGTGGCCTGGCGGGCGG + Intronic
968742043 4:2335989-2336011 TCCCTAAATGCCCTGGCAGGTGG + Intronic
972034796 4:34506829-34506851 CCCCTCACTGCCCAGGCCGCTGG + Intergenic
974205746 4:58701164-58701186 CCTCTCAGTGCTCTGGTGGGTGG + Intergenic
976218788 4:82739489-82739511 CCCCGCACTGCCCTGGAGGGAGG + Intronic
976565530 4:86547406-86547428 CCCCTCACTGCCCCGGGCGGTGG - Intronic
978514599 4:109557513-109557535 CCCTTCACTGCCCGGGCCGGGGG - Intergenic
979609007 4:122670325-122670347 CCCCTCACTGCCCGGTCCGGCGG - Intergenic
979755866 4:124339162-124339184 CCCCTCACTGCCCGGGCCAGTGG - Intergenic
979822552 4:125192058-125192080 CCCCTCACTGGCCGGGCGGTGGG - Intergenic
981136192 4:141213663-141213685 CCCCTCACTGCCCGGGGCGGTGG - Intergenic
982784269 4:159523433-159523455 CCCCTCACTGGCCGGGCGGGGGG - Intergenic
983064095 4:163189966-163189988 CCCCTCATTGCCAGGGCCGGCGG + Intergenic
984241835 4:177227779-177227801 CCCCTCACTGCCCAGGCCGGTGG + Intergenic
985539307 5:480490-480512 CCACCCTGTGCCCTGGAGGGCGG - Intronic
985639552 5:1057309-1057331 CCCCTCAGTGCCCACTCAGGCGG + Intronic
986993278 5:13578619-13578641 CCCCTCACTGCCCGGGCCGGCGG - Intergenic
987099171 5:14577365-14577387 CCCCTCACTGCCAGGGCTGGCGG - Intergenic
988291759 5:29296696-29296718 CCCCTCACTGCCCTGGCGGTGGG + Intergenic
990510845 5:56487884-56487906 CCCCTCACTGCCCGAGCCGGTGG - Intergenic
990869472 5:60415564-60415586 CCCCTCACTGCCCGGGGTGGCGG - Intronic
991657788 5:68920977-68920999 CCCCTCACTGCCCTGGCCGCGGG - Intergenic
992484028 5:77178869-77178891 ACCCTCAGTTCCCTGCCGGGTGG + Intergenic
992733366 5:79694005-79694027 TCCCTCAGTGCCCTTGCAGCTGG - Intronic
993770280 5:91917386-91917408 CCCCTCATTGCCCCGGGCGGCGG - Intergenic
994239861 5:97407274-97407296 CCCCTCACTGTCCGGGCCGGCGG - Intergenic
994251526 5:97542131-97542153 CCCCTCAGTGCCCAGGGCGGCGG + Intergenic
994768645 5:103954065-103954087 CGCCTCACTGCCCAGGCCGGCGG + Intergenic
995032314 5:107494353-107494375 CCCCTCACTGCCCGGGCGGCAGG - Intronic
995840139 5:116436324-116436346 GGCCTCAGTGTCCTGGCTGGAGG + Intergenic
995975801 5:118033886-118033908 CCCCTCATTGCCCTGGCCAGCGG - Intergenic
997309415 5:132867101-132867123 CCCCTCTGAGCGCTGGCGGCCGG + Intronic
999244701 5:150147635-150147657 CCCCTCAGAGCCCTCCTGGGCGG + Intronic
1001433403 5:171681234-171681256 CACCACAGTGTCCTGGAGGGAGG + Intergenic
1001636441 5:173213554-173213576 CCCCTCACTGCCCAGGCTGGCGG - Intergenic
1001686185 5:173596656-173596678 CCCCTCAGTGCACTTGAGGGCGG + Intergenic
1002106280 5:176880830-176880852 CCCCTATGTGCCCCGGCGGCCGG - Exonic
1002416833 5:179125177-179125199 CCCCGCTCTGCCCTGGCAGGTGG - Exonic
1002693792 5:181070628-181070650 CCCCTCTGTGCTCTTGGGGGAGG - Intergenic
1003176866 6:3758272-3758294 CCCCTCAGTGCCCGGCCGGCGGG - Intergenic
1003897016 6:10617268-10617290 CCCCTCACTGCCCCGGGCGGCGG + Intronic
1004647940 6:17580856-17580878 CCCCTCACTGCCCAGGCCGGCGG - Intergenic
1004660576 6:17706240-17706262 CGCCGCGGTGGCCTGGCGGGTGG - Intronic
1004908517 6:20259680-20259702 CTCCTCACTGCCCGGGCCGGCGG - Intergenic
1007328201 6:41080035-41080057 CACACCAGTGCCCTGGAGGGTGG + Intronic
1013694806 6:112689573-112689595 CCCCTCACTGCCCGGGGCGGTGG + Intergenic
1013960086 6:115889211-115889233 CCCCTCACTGCCCGGGCGGCGGG - Intergenic
1017383528 6:153857190-153857212 CCCCTCACTGCCCAGGGTGGCGG + Intergenic
1018445291 6:163852771-163852793 CCCCTCAGTGTTCTGGGTGGAGG + Intergenic
1018860533 6:167708020-167708042 CCCCACAGTGCTCAGGGGGGAGG + Intergenic
1018906991 6:168081230-168081252 CCCCTCAGTGCCCTGGCGGGAGG - Intronic
1019176991 6:170165087-170165109 CCCCACAGTGACCTGGCATGAGG + Intergenic
1019344005 7:520860-520882 CTCGTCAGTGCCCTGCCAGGGGG + Intergenic
1019599603 7:1874730-1874752 ACACTAAGTGCCCAGGCGGGAGG - Intronic
1019611130 7:1937214-1937236 ACACTCAGTGCCCGGGAGGGAGG + Intronic
1020008279 7:4793637-4793659 CCCCTCACTGCCCAGGCTGGCGG - Intronic
1021359419 7:19692499-19692521 CCCCTCACTGCCCTGGGCCGGGG + Intergenic
1021600156 7:22356750-22356772 CCCCTCAGCGGCCCGGGGGGTGG + Intronic
1024741774 7:52362760-52362782 CCCCTCACTGCCCTGGGCGGCGG - Intergenic
1025102963 7:56150780-56150802 CCCCTCACTGGCCGGGCGGGGGG - Intergenic
1025840332 7:65141013-65141035 GCCCTCAGAGCCGTGGCGGCGGG - Intergenic
1027221749 7:76218494-76218516 GCCCTCAGTGGCCTTGTGGGAGG - Intronic
1027956043 7:84880684-84880706 CCCCTCACTGCCGCGGCGGCGGG - Intergenic
1028685425 7:93585812-93585834 CCCCTCACCTCCCGGGCGGGGGG + Intergenic
1029370658 7:100148709-100148731 CCCCTCAGTGCCTGAGCGAGAGG - Intergenic
1029601144 7:101564061-101564083 CTCCTTAGTGCCCAGGCAGGTGG - Intergenic
1031077804 7:117229513-117229535 CCCCTCACTCCCCTGACAGGTGG - Intronic
1031403007 7:121347445-121347467 CCCCTCACTGGCCTGGAGGAAGG + Intergenic
1031605525 7:123763422-123763444 CCCCTCACTGCCCGGGGTGGCGG + Intergenic
1032528943 7:132604132-132604154 CCCCTCTGTGTTCTGGCGGGGGG + Intronic
1034398950 7:150848707-150848729 TCCCTCAGTGCCTTGGCTTGTGG - Intronic
1034678762 7:152911898-152911920 GCTCTCAGGGCCCTGGCAGGAGG + Intergenic
1035158641 7:156934798-156934820 TACCTCAGTGCCCAGGAGGGTGG - Intergenic
1036656626 8:10681353-10681375 CCCCTCTGTGCCACGGCTGGTGG - Intronic
1036801365 8:11794912-11794934 CCCCTCACTGCCCTGGCCGGCGG - Intergenic
1037239515 8:16760764-16760786 CCCCTCACTGCCTGGGCCGGCGG + Intergenic
1038008715 8:23457329-23457351 CCCCTGTGAGCCCTGGCGGCCGG - Intronic
1038422626 8:27443133-27443155 CACATCAGTGCCCTGGCAGGTGG + Intronic
1039576629 8:38628878-38628900 TCCCTCAGTGCCCTGTCATGGGG - Intergenic
1040723115 8:50350025-50350047 CCCCTCATTGCCCGGCCGGCAGG - Intronic
1042857105 8:73278445-73278467 CCCCTCAGCGCCCGGGCGTCAGG - Intergenic
1043670631 8:82880798-82880820 CCCCTCACTGCCCGGGCTGGTGG - Intergenic
1044628892 8:94260462-94260484 GCCCACAGTGCCCTGGCGCATGG + Exonic
1044943279 8:97365381-97365403 CCCCTCAGCCCCATGGCAGGTGG + Intergenic
1045029055 8:98117599-98117621 CCCTTCATTGCCCCGCCGGGTGG + Intronic
1048279736 8:133096272-133096294 CTCTTCAGTGCTCTGGCTGGAGG - Exonic
1048576035 8:135690664-135690686 CCCCTCACTGCCGGGGCCGGCGG + Intergenic
1049220014 8:141424869-141424891 CCCCTCAGTCCCCTGGGGCAGGG - Intronic
1049446169 8:142632554-142632576 CCCCTCAGAGGCTTGTCGGGGGG + Intergenic
1049446179 8:142632580-142632602 CCCCTCAGAGGCTTGTCGGGGGG + Intergenic
1049453497 8:142675316-142675338 CACCTTAGTGCCCAGGCAGGAGG + Intronic
1049621773 8:143601489-143601511 CTCCTCAGAGCCCTGGAGGCAGG - Exonic
1050535245 9:6625201-6625223 TCCCTCAGTGACCCGGCCGGAGG + Intronic
1050975257 9:11929106-11929128 TCCCTCACTGCCCGGGCCGGTGG + Intergenic
1051193380 9:14537280-14537302 CCCCTCAGGACACTGGCTGGAGG - Intergenic
1051477882 9:17528500-17528522 CTCCTCAGTGTCCTTTCGGGTGG - Intergenic
1052313428 9:27092763-27092785 CCCCTCACTGCCCGGGCCGGTGG - Intergenic
1053428018 9:38023794-38023816 CCCCTCAGGGCCCTGGATGCTGG - Intronic
1055586117 9:77761175-77761197 CCCCTCACTGGCCGGGCGGGAGG - Intronic
1057292961 9:93818891-93818913 GCCCTCTGAGCCCTGGCTGGAGG + Intergenic
1057765141 9:97910078-97910100 CCCCTCACTGCCCTGCTGGAAGG - Exonic
1059791159 9:117642979-117643001 CCCCTCACTGCCCGGGCCGGCGG + Intergenic
1059885844 9:118743822-118743844 CCCCTCACTGCTCTGACAGGAGG + Intergenic
1060464469 9:123890474-123890496 CCCCTCACAGGCTTGGCGGGAGG - Intronic
1061678520 9:132231424-132231446 CCCCACAGAGCCCTGGTGGAGGG - Intronic
1061801932 9:133117498-133117520 CCCAACAGTGGCTTGGCGGGCGG - Intronic
1061921943 9:133787372-133787394 CCCCCCAGTGCCCAGGCTGGGGG + Intronic
1062566615 9:137166515-137166537 CCCCTCAGTGCACTGGAAGCGGG + Intronic
1062656770 9:137607647-137607669 ACCCTCAGCGCCCTGGCAAGTGG + Intronic
1062695794 9:137875749-137875771 ACCCTCGGTGACCTGGCAGGAGG + Intergenic
1203523789 Un_GL000213v1:68087-68109 CCCCTCAGCGCCCTGGACTGTGG + Intergenic
1186657390 X:11629699-11629721 CCACTCAGTGCCTTGGGGAGCGG - Intronic
1188242553 X:27809246-27809268 CCCCTCACTGCCTGGGCCGGGGG - Intronic
1188976042 X:36676791-36676813 CGCCTCAGAACCATGGCGGGAGG + Intergenic
1189589115 X:42493197-42493219 CCCCTCAGTGGCCTGGGGCTTGG + Intergenic
1192186756 X:68952266-68952288 CCCCTCACTGCCCAGGCCGGCGG - Intergenic
1194434699 X:93855953-93855975 CCCCTCAGTGCTCTGGTTGTGGG + Intergenic
1196197928 X:112855107-112855129 CCCCTCACTGCCCGGGGCGGTGG + Intergenic
1196706367 X:118720995-118721017 CCACTCAGTTCCCTGGCGTTAGG - Intergenic
1196827343 X:119751273-119751295 TCCCTCAGTGCAGCGGCGGGCGG + Intergenic
1200403955 Y:2789962-2789984 TCCCTCGGGGCCCTGGCGGATGG - Intergenic