ID: 1018908302

View in Genome Browser
Species Human (GRCh38)
Location 6:168087874-168087896
Sequence TGGAAGCACCATGAGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908302_1018908314 18 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908302_1018908319 27 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908302_1018908317 23 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data
1018908302_1018908318 24 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data
1018908302_1018908316 22 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data
1018908302_1018908315 19 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908315 6:168087916-168087938 GATTGAGAACCTCAGGACCTGGG No data
1018908302_1018908313 12 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908313 6:168087909-168087931 GATCACAGATTGAGAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908302 Original CRISPR TGGAAGCACCATGAGAGGGG TGG (reversed) Intergenic