ID: 1018908303

View in Genome Browser
Species Human (GRCh38)
Location 6:168087877-168087899
Sequence GGTTGGAAGCACCATGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908303_1018908316 19 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data
1018908303_1018908313 9 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908313 6:168087909-168087931 GATCACAGATTGAGAACCTCAGG No data
1018908303_1018908317 20 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data
1018908303_1018908318 21 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data
1018908303_1018908315 16 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908315 6:168087916-168087938 GATTGAGAACCTCAGGACCTGGG No data
1018908303_1018908319 24 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908303_1018908314 15 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908303 Original CRISPR GGTTGGAAGCACCATGAGAG GGG (reversed) Intergenic
No off target data available for this crispr