ID: 1018908305

View in Genome Browser
Species Human (GRCh38)
Location 6:168087879-168087901
Sequence AGGGTTGGAAGCACCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908305_1018908315 14 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908315 6:168087916-168087938 GATTGAGAACCTCAGGACCTGGG No data
1018908305_1018908314 13 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908305_1018908317 18 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data
1018908305_1018908313 7 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908313 6:168087909-168087931 GATCACAGATTGAGAACCTCAGG No data
1018908305_1018908318 19 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data
1018908305_1018908319 22 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908305_1018908316 17 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908305 Original CRISPR AGGGTTGGAAGCACCATGAG AGG (reversed) Intergenic