ID: 1018908307

View in Genome Browser
Species Human (GRCh38)
Location 6:168087894-168087916
Sequence CTGTGATCTGGGGCCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908307_1018908322 21 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908307_1018908315 -1 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908315 6:168087916-168087938 GATTGAGAACCTCAGGACCTGGG No data
1018908307_1018908319 7 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908307_1018908317 3 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data
1018908307_1018908314 -2 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908307_1018908313 -8 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908313 6:168087909-168087931 GATCACAGATTGAGAACCTCAGG No data
1018908307_1018908316 2 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data
1018908307_1018908318 4 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908307 Original CRISPR CTGTGATCTGGGGCCAGGGT TGG (reversed) Intergenic