ID: 1018908308

View in Genome Browser
Species Human (GRCh38)
Location 6:168087898-168087920
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908308_1018908319 3 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908308_1018908315 -5 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908315 6:168087916-168087938 GATTGAGAACCTCAGGACCTGGG No data
1018908308_1018908318 0 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data
1018908308_1018908317 -1 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data
1018908308_1018908316 -2 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data
1018908308_1018908314 -6 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908308_1018908322 17 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908308 Original CRISPR CAATCTGTGATCTGGGGCCA GGG (reversed) Intergenic