ID: 1018908310

View in Genome Browser
Species Human (GRCh38)
Location 6:168087904-168087926
Sequence GGTTCTCAATCTGTGATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908310_1018908318 -6 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data
1018908310_1018908316 -8 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data
1018908310_1018908322 11 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908310_1018908319 -3 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908310_1018908317 -7 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908310 Original CRISPR GGTTCTCAATCTGTGATCTG GGG (reversed) Intergenic