ID: 1018908312

View in Genome Browser
Species Human (GRCh38)
Location 6:168087906-168087928
Sequence GAGGTTCTCAATCTGTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908312_1018908316 -10 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908316 6:168087919-168087941 TGAGAACCTCAGGACCTGGGAGG No data
1018908312_1018908318 -8 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908318 6:168087921-168087943 AGAACCTCAGGACCTGGGAGGGG No data
1018908312_1018908319 -5 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908312_1018908317 -9 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908317 6:168087920-168087942 GAGAACCTCAGGACCTGGGAGGG No data
1018908312_1018908322 9 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908312 Original CRISPR GAGGTTCTCAATCTGTGATC TGG (reversed) Intergenic