ID: 1018908314

View in Genome Browser
Species Human (GRCh38)
Location 6:168087915-168087937
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908304_1018908314 14 Left 1018908304 6:168087878-168087900 CCCTCTCATGGTGCTTCCAACCC No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908300_1018908314 28 Left 1018908300 6:168087864-168087886 CCTCACACTTCCACCCCTCTCAT No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908299_1018908314 29 Left 1018908299 6:168087863-168087885 CCCTCACACTTCCACCCCTCTCA No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908309_1018908314 -7 Left 1018908309 6:168087899-168087921 CCTGGCCCCAGATCACAGATTGA No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908308_1018908314 -6 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908307_1018908314 -2 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908302_1018908314 18 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908303_1018908314 15 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data
1018908305_1018908314 13 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908314 6:168087915-168087937 AGATTGAGAACCTCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908314 Original CRISPR AGATTGAGAACCTCAGGACC TGG Intergenic