ID: 1018908319

View in Genome Browser
Species Human (GRCh38)
Location 6:168087924-168087946
Sequence ACCTCAGGACCTGGGAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908304_1018908319 23 Left 1018908304 6:168087878-168087900 CCCTCTCATGGTGCTTCCAACCC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908311_1018908319 -4 Left 1018908311 6:168087905-168087927 CCCAGATCACAGATTGAGAACCT No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908309_1018908319 2 Left 1018908309 6:168087899-168087921 CCTGGCCCCAGATCACAGATTGA No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908312_1018908319 -5 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908305_1018908319 22 Left 1018908305 6:168087879-168087901 CCTCTCATGGTGCTTCCAACCCT No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908308_1018908319 3 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908303_1018908319 24 Left 1018908303 6:168087877-168087899 CCCCTCTCATGGTGCTTCCAACC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908307_1018908319 7 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908302_1018908319 27 Left 1018908302 6:168087874-168087896 CCACCCCTCTCATGGTGCTTCCA No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data
1018908310_1018908319 -3 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908319 6:168087924-168087946 ACCTCAGGACCTGGGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908319 Original CRISPR ACCTCAGGACCTGGGAGGGG CGG Intergenic