ID: 1018908322

View in Genome Browser
Species Human (GRCh38)
Location 6:168087938-168087960
Sequence GAGGGGCGGCATGAGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908311_1018908322 10 Left 1018908311 6:168087905-168087927 CCCAGATCACAGATTGAGAACCT No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908308_1018908322 17 Left 1018908308 6:168087898-168087920 CCCTGGCCCCAGATCACAGATTG No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908309_1018908322 16 Left 1018908309 6:168087899-168087921 CCTGGCCCCAGATCACAGATTGA No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908307_1018908322 21 Left 1018908307 6:168087894-168087916 CCAACCCTGGCCCCAGATCACAG No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908310_1018908322 11 Left 1018908310 6:168087904-168087926 CCCCAGATCACAGATTGAGAACC No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908312_1018908322 9 Left 1018908312 6:168087906-168087928 CCAGATCACAGATTGAGAACCTC No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data
1018908320_1018908322 -10 Left 1018908320 6:168087925-168087947 CCTCAGGACCTGGGAGGGGCGGC No data
Right 1018908322 6:168087938-168087960 GAGGGGCGGCATGAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908322 Original CRISPR GAGGGGCGGCATGAGCCAGC AGG Intergenic