ID: 1018908796

View in Genome Browser
Species Human (GRCh38)
Location 6:168090123-168090145
Sequence GGTCCCAGTGGTGGACGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908796_1018908810 20 Left 1018908796 6:168090123-168090145 CCTCCACGTCCACCACTGGGACC No data
Right 1018908810 6:168090166-168090188 CCCTCCTGAATGTTGGCAATGGG No data
1018908796_1018908801 -10 Left 1018908796 6:168090123-168090145 CCTCCACGTCCACCACTGGGACC No data
Right 1018908801 6:168090136-168090158 CACTGGGACCCACCCCTGGTTGG No data
1018908796_1018908807 13 Left 1018908796 6:168090123-168090145 CCTCCACGTCCACCACTGGGACC No data
Right 1018908807 6:168090159-168090181 CTCGTCTCCCTCCTGAATGTTGG No data
1018908796_1018908808 19 Left 1018908796 6:168090123-168090145 CCTCCACGTCCACCACTGGGACC No data
Right 1018908808 6:168090165-168090187 TCCCTCCTGAATGTTGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908796 Original CRISPR GGTCCCAGTGGTGGACGTGG AGG (reversed) Intergenic
No off target data available for this crispr