ID: 1018908878

View in Genome Browser
Species Human (GRCh38)
Location 6:168090506-168090528
Sequence CAGTGAGAACAGGGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908878_1018908885 3 Left 1018908878 6:168090506-168090528 CCATCTTCTCCCTGTTCTCACTG No data
Right 1018908885 6:168090532-168090554 GCTCTGATGCTGCATTCATGGGG No data
1018908878_1018908884 2 Left 1018908878 6:168090506-168090528 CCATCTTCTCCCTGTTCTCACTG No data
Right 1018908884 6:168090531-168090553 GGCTCTGATGCTGCATTCATGGG No data
1018908878_1018908886 6 Left 1018908878 6:168090506-168090528 CCATCTTCTCCCTGTTCTCACTG No data
Right 1018908886 6:168090535-168090557 CTGATGCTGCATTCATGGGGAGG No data
1018908878_1018908883 1 Left 1018908878 6:168090506-168090528 CCATCTTCTCCCTGTTCTCACTG No data
Right 1018908883 6:168090530-168090552 CGGCTCTGATGCTGCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908878 Original CRISPR CAGTGAGAACAGGGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr