ID: 1018908925

View in Genome Browser
Species Human (GRCh38)
Location 6:168090834-168090856
Sequence GGACAGAGTAGCCCCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018908925_1018908929 0 Left 1018908925 6:168090834-168090856 CCCTCTTGGGGGCTACTCTGTCC No data
Right 1018908929 6:168090857-168090879 ATTTTACTGATCTGCCAATCGGG No data
1018908925_1018908928 -1 Left 1018908925 6:168090834-168090856 CCCTCTTGGGGGCTACTCTGTCC No data
Right 1018908928 6:168090856-168090878 CATTTTACTGATCTGCCAATCGG No data
1018908925_1018908930 1 Left 1018908925 6:168090834-168090856 CCCTCTTGGGGGCTACTCTGTCC No data
Right 1018908930 6:168090858-168090880 TTTTACTGATCTGCCAATCGGGG No data
1018908925_1018908932 28 Left 1018908925 6:168090834-168090856 CCCTCTTGGGGGCTACTCTGTCC No data
Right 1018908932 6:168090885-168090907 CGAAGCCAGCTCCAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018908925 Original CRISPR GGACAGAGTAGCCCCCAAGA GGG (reversed) Intergenic
No off target data available for this crispr