ID: 1018910072

View in Genome Browser
Species Human (GRCh38)
Location 6:168096699-168096721
Sequence CTTCCTAGGTGGCATCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018910066_1018910072 -1 Left 1018910066 6:168096677-168096699 CCTCCTGTTAGGATATGTTTCCC No data
Right 1018910072 6:168096699-168096721 CTTCCTAGGTGGCATCAGAGCGG No data
1018910063_1018910072 14 Left 1018910063 6:168096662-168096684 CCAGATGCTCCGAAGCCTCCTGT No data
Right 1018910072 6:168096699-168096721 CTTCCTAGGTGGCATCAGAGCGG No data
1018910067_1018910072 -4 Left 1018910067 6:168096680-168096702 CCTGTTAGGATATGTTTCCCTTC No data
Right 1018910072 6:168096699-168096721 CTTCCTAGGTGGCATCAGAGCGG No data
1018910065_1018910072 5 Left 1018910065 6:168096671-168096693 CCGAAGCCTCCTGTTAGGATATG No data
Right 1018910072 6:168096699-168096721 CTTCCTAGGTGGCATCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018910072 Original CRISPR CTTCCTAGGTGGCATCAGAG CGG Intergenic
No off target data available for this crispr