ID: 1018913452

View in Genome Browser
Species Human (GRCh38)
Location 6:168117657-168117679
Sequence CCCCATCATAAGCAGGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018913442_1018913452 6 Left 1018913442 6:168117628-168117650 CCAGAGAGGCAGATTCAGCCAAG No data
Right 1018913452 6:168117657-168117679 CCCCATCATAAGCAGGGCAGGGG No data
1018913441_1018913452 18 Left 1018913441 6:168117616-168117638 CCAGGTTCTCTTCCAGAGAGGCA No data
Right 1018913452 6:168117657-168117679 CCCCATCATAAGCAGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018913452 Original CRISPR CCCCATCATAAGCAGGGCAG GGG Intergenic
No off target data available for this crispr