ID: 1018914271

View in Genome Browser
Species Human (GRCh38)
Location 6:168123251-168123273
Sequence TATCACAGCGGACAGCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018914267_1018914271 21 Left 1018914267 6:168123207-168123229 CCCAGTCTCAGGTAGTTCTTCAT 0: 74
1: 1689
2: 4501
3: 9281
4: 11424
Right 1018914271 6:168123251-168123273 TATCACAGCGGACAGCACCCCGG No data
1018914268_1018914271 20 Left 1018914268 6:168123208-168123230 CCAGTCTCAGGTAGTTCTTCATA 0: 80
1: 1722
2: 4382
3: 6336
4: 10248
Right 1018914271 6:168123251-168123273 TATCACAGCGGACAGCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018914271 Original CRISPR TATCACAGCGGACAGCACCC CGG Intergenic
No off target data available for this crispr