ID: 1018915274

View in Genome Browser
Species Human (GRCh38)
Location 6:168129092-168129114
Sequence AGGCCTAGGCGGGGCCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018915274_1018915286 9 Left 1018915274 6:168129092-168129114 CCTCTCCGGCCCCGCCTAGGCCT No data
Right 1018915286 6:168129124-168129146 GGTGGCCTCACCTCCCCTGCGGG No data
1018915274_1018915293 28 Left 1018915274 6:168129092-168129114 CCTCTCCGGCCCCGCCTAGGCCT No data
Right 1018915293 6:168129143-168129165 CGGGCACCGGCCAGCTGCTAAGG No data
1018915274_1018915288 15 Left 1018915274 6:168129092-168129114 CCTCTCCGGCCCCGCCTAGGCCT No data
Right 1018915288 6:168129130-168129152 CTCACCTCCCCTGCGGGCACCGG No data
1018915274_1018915285 8 Left 1018915274 6:168129092-168129114 CCTCTCCGGCCCCGCCTAGGCCT No data
Right 1018915285 6:168129123-168129145 AGGTGGCCTCACCTCCCCTGCGG No data
1018915274_1018915283 -9 Left 1018915274 6:168129092-168129114 CCTCTCCGGCCCCGCCTAGGCCT No data
Right 1018915283 6:168129106-168129128 CCTAGGCCTCGGAGGTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018915274 Original CRISPR AGGCCTAGGCGGGGCCGGAG AGG (reversed) Intergenic
No off target data available for this crispr