ID: 1018916222

View in Genome Browser
Species Human (GRCh38)
Location 6:168134179-168134201
Sequence CCATGTGTCCAGAGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018916222_1018916229 6 Left 1018916222 6:168134179-168134201 CCATCTGTCCTCTGGACACATGG No data
Right 1018916229 6:168134208-168134230 TGCTAAGCAAAGAGGGCTGAAGG No data
1018916222_1018916228 -1 Left 1018916222 6:168134179-168134201 CCATCTGTCCTCTGGACACATGG No data
Right 1018916228 6:168134201-168134223 GCTGGGATGCTAAGCAAAGAGGG No data
1018916222_1018916227 -2 Left 1018916222 6:168134179-168134201 CCATCTGTCCTCTGGACACATGG No data
Right 1018916227 6:168134200-168134222 GGCTGGGATGCTAAGCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018916222 Original CRISPR CCATGTGTCCAGAGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr