ID: 1018916370

View in Genome Browser
Species Human (GRCh38)
Location 6:168134963-168134985
Sequence TGACGACTGGACGTCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018916370_1018916372 -8 Left 1018916370 6:168134963-168134985 CCAGCGTGGACGTCCAGTCGTCA No data
Right 1018916372 6:168134978-168135000 AGTCGTCAGATGCAGCCACTTGG No data
1018916370_1018916374 0 Left 1018916370 6:168134963-168134985 CCAGCGTGGACGTCCAGTCGTCA No data
Right 1018916374 6:168134986-168135008 GATGCAGCCACTTGGTGGTCAGG No data
1018916370_1018916373 -5 Left 1018916370 6:168134963-168134985 CCAGCGTGGACGTCCAGTCGTCA No data
Right 1018916373 6:168134981-168135003 CGTCAGATGCAGCCACTTGGTGG No data
1018916370_1018916375 4 Left 1018916370 6:168134963-168134985 CCAGCGTGGACGTCCAGTCGTCA No data
Right 1018916375 6:168134990-168135012 CAGCCACTTGGTGGTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018916370 Original CRISPR TGACGACTGGACGTCCACGC TGG (reversed) Intergenic
No off target data available for this crispr