ID: 1018916375

View in Genome Browser
Species Human (GRCh38)
Location 6:168134990-168135012
Sequence CAGCCACTTGGTGGTCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018916370_1018916375 4 Left 1018916370 6:168134963-168134985 CCAGCGTGGACGTCCAGTCGTCA No data
Right 1018916375 6:168134990-168135012 CAGCCACTTGGTGGTCAGGCAGG No data
1018916371_1018916375 -9 Left 1018916371 6:168134976-168134998 CCAGTCGTCAGATGCAGCCACTT No data
Right 1018916375 6:168134990-168135012 CAGCCACTTGGTGGTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018916375 Original CRISPR CAGCCACTTGGTGGTCAGGC AGG Intergenic
No off target data available for this crispr