ID: 1018917100

View in Genome Browser
Species Human (GRCh38)
Location 6:168140243-168140265
Sequence TCACTACTGTTCTCAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018917092_1018917100 -6 Left 1018917092 6:168140226-168140248 CCCACCACCCCACCCTCTCACTA No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917087_1018917100 2 Left 1018917087 6:168140218-168140240 CCCCCTGCCCCACCACCCCACCC No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917091_1018917100 -5 Left 1018917091 6:168140225-168140247 CCCCACCACCCCACCCTCTCACT No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917086_1018917100 8 Left 1018917086 6:168140212-168140234 CCAACTCCCCCTGCCCCACCACC No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917084_1018917100 13 Left 1018917084 6:168140207-168140229 CCATCCCAACTCCCCCTGCCCCA No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917088_1018917100 1 Left 1018917088 6:168140219-168140241 CCCCTGCCCCACCACCCCACCCT No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917083_1018917100 21 Left 1018917083 6:168140199-168140221 CCAATTAACCATCCCAACTCCCC 0: 3
1: 30
2: 192
3: 667
4: 1208
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917085_1018917100 9 Left 1018917085 6:168140211-168140233 CCCAACTCCCCCTGCCCCACCAC No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917094_1018917100 -10 Left 1018917094 6:168140230-168140252 CCACCCCACCCTCTCACTACTGT No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917093_1018917100 -7 Left 1018917093 6:168140227-168140249 CCACCACCCCACCCTCTCACTAC No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917089_1018917100 0 Left 1018917089 6:168140220-168140242 CCCTGCCCCACCACCCCACCCTC No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data
1018917090_1018917100 -1 Left 1018917090 6:168140221-168140243 CCTGCCCCACCACCCCACCCTCT No data
Right 1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018917100 Original CRISPR TCACTACTGTTCTCAGCCTC TGG Intergenic
No off target data available for this crispr