ID: 1018918677

View in Genome Browser
Species Human (GRCh38)
Location 6:168155275-168155297
Sequence CTCCATCTTCTGATGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018918677_1018918683 -8 Left 1018918677 6:168155275-168155297 CCATGGCCCATCAGAAGATGGAG No data
Right 1018918683 6:168155290-168155312 AGATGGAGAAACTAGACAGGGGG No data
1018918677_1018918684 -7 Left 1018918677 6:168155275-168155297 CCATGGCCCATCAGAAGATGGAG No data
Right 1018918684 6:168155291-168155313 GATGGAGAAACTAGACAGGGGGG No data
1018918677_1018918682 -9 Left 1018918677 6:168155275-168155297 CCATGGCCCATCAGAAGATGGAG No data
Right 1018918682 6:168155289-168155311 AAGATGGAGAAACTAGACAGGGG No data
1018918677_1018918681 -10 Left 1018918677 6:168155275-168155297 CCATGGCCCATCAGAAGATGGAG No data
Right 1018918681 6:168155288-168155310 GAAGATGGAGAAACTAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018918677 Original CRISPR CTCCATCTTCTGATGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr