ID: 1018919567

View in Genome Browser
Species Human (GRCh38)
Location 6:168161737-168161759
Sequence CGGTTGTCAGTGTTCAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018919567_1018919573 15 Left 1018919567 6:168161737-168161759 CCCATGTTGAACACTGACAACCG No data
Right 1018919573 6:168161775-168161797 CAATTATTTAAGCGATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018919567 Original CRISPR CGGTTGTCAGTGTTCAACAT GGG (reversed) Intergenic
No off target data available for this crispr