ID: 1018920369

View in Genome Browser
Species Human (GRCh38)
Location 6:168168195-168168217
Sequence CCCCCTGGGTCCCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018920369_1018920377 9 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920377 6:168168227-168168249 AGGGCTGATTTTCATTGAGAAGG No data
1018920369_1018920382 19 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920382 6:168168237-168168259 TTCATTGAGAAGGCATTGGGGGG No data
1018920369_1018920379 16 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920379 6:168168234-168168256 ATTTTCATTGAGAAGGCATTGGG No data
1018920369_1018920381 18 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920381 6:168168236-168168258 TTTCATTGAGAAGGCATTGGGGG No data
1018920369_1018920380 17 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920380 6:168168235-168168257 TTTTCATTGAGAAGGCATTGGGG No data
1018920369_1018920374 -10 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920374 6:168168208-168168230 ACCCAGGGGGGTTCACTGAAGGG No data
1018920369_1018920378 15 Left 1018920369 6:168168195-168168217 CCAGCCTCAGGGGACCCAGGGGG No data
Right 1018920378 6:168168233-168168255 GATTTTCATTGAGAAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018920369 Original CRISPR CCCCCTGGGTCCCCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr