ID: 1018920605

View in Genome Browser
Species Human (GRCh38)
Location 6:168169795-168169817
Sequence GTGATTCTCGCATGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018920600_1018920605 1 Left 1018920600 6:168169771-168169793 CCACGTGGGTTGAATGGCGTGTT No data
Right 1018920605 6:168169795-168169817 GTGATTCTCGCATGTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018920605 Original CRISPR GTGATTCTCGCATGTTTTGG GGG Intergenic
No off target data available for this crispr