ID: 1018925311

View in Genome Browser
Species Human (GRCh38)
Location 6:168201733-168201755
Sequence CCACCCAACTTGGGTCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018925301_1018925311 5 Left 1018925301 6:168201705-168201727 CCGTGGGGAGGCCTCAAACCCAA No data
Right 1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG No data
1018925294_1018925311 26 Left 1018925294 6:168201684-168201706 CCAAACTTCTTCTCCACAGGCCC No data
Right 1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG No data
1018925299_1018925311 13 Left 1018925299 6:168201697-168201719 CCACAGGCCCGTGGGGAGGCCTC No data
Right 1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG No data
1018925300_1018925311 6 Left 1018925300 6:168201704-168201726 CCCGTGGGGAGGCCTCAAACCCA No data
Right 1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG No data
1018925302_1018925311 -6 Left 1018925302 6:168201716-168201738 CCTCAAACCCAAGACCCCCACCC No data
Right 1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018925311 Original CRISPR CCACCCAACTTGGGTCAATC AGG Intergenic
No off target data available for this crispr