ID: 1018925959

View in Genome Browser
Species Human (GRCh38)
Location 6:168207252-168207274
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018925959_1018925970 17 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925970 6:168207292-168207314 CTTTCTAAGGAAGGGAGAGGGGG No data
1018925959_1018925965 8 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG No data
1018925959_1018925967 14 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925967 6:168207289-168207311 GATCTTTCTAAGGAAGGGAGAGG No data
1018925959_1018925968 15 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925968 6:168207290-168207312 ATCTTTCTAAGGAAGGGAGAGGG No data
1018925959_1018925966 9 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925966 6:168207284-168207306 TATCTGATCTTTCTAAGGAAGGG No data
1018925959_1018925969 16 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925969 6:168207291-168207313 TCTTTCTAAGGAAGGGAGAGGGG No data
1018925959_1018925963 4 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925963 6:168207279-168207301 TCCTGTATCTGATCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018925959 Original CRISPR ACAGTAAGTGGTCCCTGAGC GGG (reversed) Intergenic