ID: 1018925965

View in Genome Browser
Species Human (GRCh38)
Location 6:168207283-168207305
Sequence GTATCTGATCTTTCTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018925959_1018925965 8 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG No data
1018925960_1018925965 7 Left 1018925960 6:168207253-168207275 CCGCTCAGGGACCACTTACTGTG No data
Right 1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG No data
1018925962_1018925965 -4 Left 1018925962 6:168207264-168207286 CCACTTACTGTGGTCTCCTGTAT No data
Right 1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018925965 Original CRISPR GTATCTGATCTTTCTAAGGA AGG Intergenic
No off target data available for this crispr