ID: 1018925969

View in Genome Browser
Species Human (GRCh38)
Location 6:168207291-168207313
Sequence TCTTTCTAAGGAAGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018925962_1018925969 4 Left 1018925962 6:168207264-168207286 CCACTTACTGTGGTCTCCTGTAT No data
Right 1018925969 6:168207291-168207313 TCTTTCTAAGGAAGGGAGAGGGG No data
1018925959_1018925969 16 Left 1018925959 6:168207252-168207274 CCCGCTCAGGGACCACTTACTGT No data
Right 1018925969 6:168207291-168207313 TCTTTCTAAGGAAGGGAGAGGGG No data
1018925960_1018925969 15 Left 1018925960 6:168207253-168207275 CCGCTCAGGGACCACTTACTGTG No data
Right 1018925969 6:168207291-168207313 TCTTTCTAAGGAAGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018925969 Original CRISPR TCTTTCTAAGGAAGGGAGAG GGG Intergenic