ID: 1018926540

View in Genome Browser
Species Human (GRCh38)
Location 6:168210885-168210907
Sequence GCTGCAAGTGCACACCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018926540_1018926541 -5 Left 1018926540 6:168210885-168210907 CCAGCTGGGTGTGCACTTGCAGC No data
Right 1018926541 6:168210903-168210925 GCAGCCCCAAACATGCCCCGCGG No data
1018926540_1018926549 19 Left 1018926540 6:168210885-168210907 CCAGCTGGGTGTGCACTTGCAGC No data
Right 1018926549 6:168210927-168210949 TCCCACCCTCCAGCGTTGCTGGG No data
1018926540_1018926548 18 Left 1018926540 6:168210885-168210907 CCAGCTGGGTGTGCACTTGCAGC No data
Right 1018926548 6:168210926-168210948 ATCCCACCCTCCAGCGTTGCTGG No data
1018926540_1018926555 29 Left 1018926540 6:168210885-168210907 CCAGCTGGGTGTGCACTTGCAGC No data
Right 1018926555 6:168210937-168210959 CAGCGTTGCTGGGTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018926540 Original CRISPR GCTGCAAGTGCACACCCAGC TGG (reversed) Intergenic
No off target data available for this crispr