ID: 1018926585

View in Genome Browser
Species Human (GRCh38)
Location 6:168211064-168211086
Sequence CAGTGTGGCTGCATTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018926572_1018926585 21 Left 1018926572 6:168211020-168211042 CCGAGTGACTCTGTGCCCCAGAA No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926575_1018926585 5 Left 1018926575 6:168211036-168211058 CCCAGAATCCCTAGGCTAACCTA No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926574_1018926585 6 Left 1018926574 6:168211035-168211057 CCCCAGAATCCCTAGGCTAACCT No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926576_1018926585 4 Left 1018926576 6:168211037-168211059 CCAGAATCCCTAGGCTAACCTAA No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926577_1018926585 -3 Left 1018926577 6:168211044-168211066 CCCTAGGCTAACCTAAGCCCCAG No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926578_1018926585 -4 Left 1018926578 6:168211045-168211067 CCTAGGCTAACCTAAGCCCCAGT No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926571_1018926585 22 Left 1018926571 6:168211019-168211041 CCCGAGTGACTCTGTGCCCCAGA No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926570_1018926585 23 Left 1018926570 6:168211018-168211040 CCCCGAGTGACTCTGTGCCCCAG No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data
1018926569_1018926585 30 Left 1018926569 6:168211011-168211033 CCTGGTGCCCCGAGTGACTCTGT No data
Right 1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018926585 Original CRISPR CAGTGTGGCTGCATTGGAGA TGG Intergenic
No off target data available for this crispr