ID: 1018928425

View in Genome Browser
Species Human (GRCh38)
Location 6:168222976-168222998
Sequence CTACCTCGATGAGGCCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018928425_1018928432 16 Left 1018928425 6:168222976-168222998 CCGCCAGGGCCTCATCGAGGTAG No data
Right 1018928432 6:168223015-168223037 AACCCACACAAGGAATAAGCAGG No data
1018928425_1018928433 17 Left 1018928425 6:168222976-168222998 CCGCCAGGGCCTCATCGAGGTAG No data
Right 1018928433 6:168223016-168223038 ACCCACACAAGGAATAAGCAGGG No data
1018928425_1018928436 28 Left 1018928425 6:168222976-168222998 CCGCCAGGGCCTCATCGAGGTAG No data
Right 1018928436 6:168223027-168223049 GAATAAGCAGGGACCAGTGCAGG No data
1018928425_1018928431 6 Left 1018928425 6:168222976-168222998 CCGCCAGGGCCTCATCGAGGTAG No data
Right 1018928431 6:168223005-168223027 AGGGTTAAATAACCCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018928425 Original CRISPR CTACCTCGATGAGGCCCTGG CGG (reversed) Intergenic