ID: 1018931093

View in Genome Browser
Species Human (GRCh38)
Location 6:168240895-168240917
Sequence CCTGTGATCAAGGAAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018931086_1018931093 -5 Left 1018931086 6:168240877-168240899 CCGTGTCCATCTGAACCTCCTGT No data
Right 1018931093 6:168240895-168240917 CCTGTGATCAAGGAAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018931093 Original CRISPR CCTGTGATCAAGGAAGGGTC AGG Intergenic
No off target data available for this crispr