ID: 1018931323

View in Genome Browser
Species Human (GRCh38)
Location 6:168242151-168242173
Sequence CTGTCTGAGCAGGGGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018931311_1018931323 23 Left 1018931311 6:168242105-168242127 CCTGTTGAGACTTGGGGTGCACA No data
Right 1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG No data
1018931310_1018931323 26 Left 1018931310 6:168242102-168242124 CCTCCTGTTGAGACTTGGGGTGC No data
Right 1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018931323 Original CRISPR CTGTCTGAGCAGGGGTAGGC TGG Intergenic
No off target data available for this crispr