ID: 1018932906

View in Genome Browser
Species Human (GRCh38)
Location 6:168253553-168253575
Sequence CAGGAGAAGCACCATCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018932906_1018932907 -10 Left 1018932906 6:168253553-168253575 CCGAGATGATGGTGCTTCTCCTG No data
Right 1018932907 6:168253566-168253588 GCTTCTCCTGCTCTGACACTCGG No data
1018932906_1018932909 6 Left 1018932906 6:168253553-168253575 CCGAGATGATGGTGCTTCTCCTG No data
Right 1018932909 6:168253582-168253604 CACTCGGAAATAGCAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018932906 Original CRISPR CAGGAGAAGCACCATCATCT CGG (reversed) Intergenic
No off target data available for this crispr