ID: 1018932909

View in Genome Browser
Species Human (GRCh38)
Location 6:168253582-168253604
Sequence CACTCGGAAATAGCAACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018932906_1018932909 6 Left 1018932906 6:168253553-168253575 CCGAGATGATGGTGCTTCTCCTG No data
Right 1018932909 6:168253582-168253604 CACTCGGAAATAGCAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018932909 Original CRISPR CACTCGGAAATAGCAACTTG AGG Intergenic
No off target data available for this crispr