ID: 1018933635

View in Genome Browser
Species Human (GRCh38)
Location 6:168259068-168259090
Sequence GCATCCGCACGCATGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018933635_1018933637 -5 Left 1018933635 6:168259068-168259090 CCACAGCTCATGCGTGCGGATGC 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1018933637 6:168259086-168259108 GATGCCTTTGCTACCCAGGACGG 0: 1
1: 0
2: 0
3: 16
4: 193
1018933635_1018933643 16 Left 1018933635 6:168259068-168259090 CCACAGCTCATGCGTGCGGATGC 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1018933643 6:168259107-168259129 GGCCATACAAGGAAGCCATTGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018933635_1018933642 15 Left 1018933635 6:168259068-168259090 CCACAGCTCATGCGTGCGGATGC 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1018933642 6:168259106-168259128 CGGCCATACAAGGAAGCCATTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1018933635_1018933639 5 Left 1018933635 6:168259068-168259090 CCACAGCTCATGCGTGCGGATGC 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1018933639 6:168259096-168259118 CTACCCAGGACGGCCATACAAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1018933635_1018933636 -9 Left 1018933635 6:168259068-168259090 CCACAGCTCATGCGTGCGGATGC 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1018933636 6:168259082-168259104 TGCGGATGCCTTTGCTACCCAGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018933635 Original CRISPR GCATCCGCACGCATGAGCTG TGG (reversed) Intergenic
903202256 1:21750930-21750952 GCATGCCCATGGATGAGCTGAGG + Intronic
907399249 1:54214490-54214512 GCTTCCCCACTCATTAGCTGTGG - Intronic
913645380 1:120849683-120849705 GCACCTGCATGCAGGAGCTGAGG + Intergenic
914081350 1:144413855-144413877 GCACCTGCACGCAGGAGCTGAGG - Intergenic
914096001 1:144544752-144544774 GCATCTGCACGGAGGAGCTGAGG + Intergenic
914176257 1:145282394-145282416 GCACCTGCACGCAGGAGCTGAGG - Intergenic
914302523 1:146389213-146389235 GCATCTGCACGGAGGAGCTGAGG - Intergenic
914512986 1:148351247-148351269 GCATCCACATGAATGAGCTGGGG + Intergenic
914530984 1:148523880-148523902 GCACCTGCACGCAGGAGCTGAGG - Intergenic
916519005 1:165546505-165546527 TCATCCTCATGCATGACCTGTGG + Intronic
923749825 1:236737245-236737267 CCATCCTCACGCAGGGGCTGAGG + Intronic
1063918377 10:10907549-10907571 GCACCCACACTCATGAGATGAGG + Intergenic
1067414662 10:46094313-46094335 GCATCCTCACCCCTGGGCTGGGG - Intergenic
1068680869 10:59818421-59818443 GAATCCACACGGCTGAGCTGGGG - Intronic
1069619459 10:69827715-69827737 GCATCAGCTCTCATCAGCTGTGG - Intronic
1070663558 10:78327903-78327925 GCATGTGCAGGCATGAGCAGTGG + Intergenic
1071447329 10:85760942-85760964 GCACTCACACCCATGAGCTGTGG + Intronic
1077843594 11:6001171-6001193 GCATCCTCCCTCCTGAGCTGTGG - Intergenic
1081011089 11:37812764-37812786 GCAGCTGCACGCAAGAGCTCGGG + Intergenic
1091388652 12:111618-111640 GCAACCTCACGCATGAGCCAAGG - Intronic
1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG + Intronic
1113389875 13:109885324-109885346 TCATCTGCACGCATCATCTGAGG - Intergenic
1122762159 14:104037248-104037270 GCAGCGGCTCGCAGGAGCTGTGG - Intronic
1122793467 14:104194157-104194179 ACATCCACACTCCTGAGCTGAGG - Intergenic
1144033131 17:11340317-11340339 GCAACCACAGGCATGAGCTCAGG - Intronic
1146797761 17:35795049-35795071 GGATCCGCACTGATGGGCTGGGG - Intronic
1147761328 17:42799224-42799246 GCAGCCGCACCCACGATCTGGGG - Exonic
1156482693 18:37446067-37446089 GCAACCGCAAGCATGAGGGGAGG - Intronic
1168427779 19:56252852-56252874 GCAGCCACAGGCAGGAGCTGGGG + Intronic
926387356 2:12349873-12349895 GGATTCACACACATGAGCTGAGG - Intergenic
934674052 2:96237055-96237077 GCAGCCACAGGCATGAGCTGAGG - Intergenic
945040234 2:205737913-205737935 GCACTCGCATGTATGAGCTGAGG - Intronic
949049795 2:241891403-241891425 GCCTCCGCAGGGAGGAGCTGCGG + Intergenic
1169046298 20:2536822-2536844 TGATCCTCACGCATGAGATGGGG + Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1180093379 21:45543420-45543442 GGACCCGCACTCTTGAGCTGTGG - Intronic
1182515323 22:30855427-30855449 GCAACCACACGCCTGTGCTGTGG - Intronic
1183736650 22:39648291-39648313 GCATGCGGACACAGGAGCTGGGG + Intronic
1185265521 22:49900665-49900687 GCATCCTCACGCATCTGCTAGGG - Exonic
952948315 3:38496321-38496343 GCATGCGCGCGCATGCGCCGTGG + Exonic
958824367 3:99012396-99012418 GACTCCGAAAGCATGAGCTGGGG - Intergenic
965628514 3:170706621-170706643 GTATCAGGACGGATGAGCTGCGG - Intronic
967631096 3:191743495-191743517 GCAACCTCGTGCATGAGCTGAGG - Intergenic
969907234 4:10408584-10408606 GGATCAGCATGCATGACCTGTGG + Intergenic
983650925 4:170035601-170035623 GCTTCCCCAAGCATGGGCTGCGG + Intergenic
992104761 5:73440823-73440845 GCCTCCTCAAGCATGGGCTGGGG - Intergenic
994810582 5:104513518-104513540 GAATCCGCAAGAATGAGCTAAGG + Intergenic
1003264549 6:4553783-4553805 GCATCCGGAAGCATGAGAAGTGG + Intergenic
1005348301 6:24911016-24911038 GCGTCCGCTCGCAGCAGCTGCGG + Intronic
1018933635 6:168259068-168259090 GCATCCGCACGCATGAGCTGTGG - Intergenic
1032922611 7:136566829-136566851 GCATCAGCTAGCATCAGCTGTGG + Intergenic
1049011152 8:139888314-139888336 GCACCCCCACGAATGAGCTTTGG + Intronic
1049888594 9:46289-46311 ACATACACACGGATGAGCTGTGG - Intergenic
1051605015 9:18909865-18909887 GCAGCCACACTCATCAGCTGTGG + Exonic
1056693579 9:88827957-88827979 GCATGCGGATGCATGTGCTGAGG + Intergenic
1061645109 9:131994821-131994843 GCAACCACAGGCATGAGCTGGGG - Intronic