ID: 1018935410

View in Genome Browser
Species Human (GRCh38)
Location 6:168270955-168270977
Sequence GTTTTTTCCTGGAGGGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018935410_1018935414 0 Left 1018935410 6:168270955-168270977 CCATTGACCCTCCAGGAAAAAAC No data
Right 1018935414 6:168270978-168271000 AAACCTCTCATCCAGATCTCAGG No data
1018935410_1018935419 30 Left 1018935410 6:168270955-168270977 CCATTGACCCTCCAGGAAAAAAC No data
Right 1018935419 6:168271008-168271030 GCACCCAGTCCACGTGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018935410 Original CRISPR GTTTTTTCCTGGAGGGTCAA TGG (reversed) Intergenic
No off target data available for this crispr