ID: 1018937473

View in Genome Browser
Species Human (GRCh38)
Location 6:168283257-168283279
Sequence GAGCCCTCTGGGCCTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018937462_1018937473 10 Left 1018937462 6:168283224-168283246 CCCGCAGTGCCCTTACGTGGTGG No data
Right 1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG No data
1018937469_1018937473 0 Left 1018937469 6:168283234-168283256 CCTTACGTGGTGGAAGGGGTGAG No data
Right 1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG No data
1018937468_1018937473 1 Left 1018937468 6:168283233-168283255 CCCTTACGTGGTGGAAGGGGTGA No data
Right 1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG No data
1018937460_1018937473 24 Left 1018937460 6:168283210-168283232 CCTAGTGTCATCTTCCCGCAGTG No data
Right 1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG No data
1018937464_1018937473 9 Left 1018937464 6:168283225-168283247 CCGCAGTGCCCTTACGTGGTGGA No data
Right 1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018937473 Original CRISPR GAGCCCTCTGGGCCTCCTGT AGG Intergenic
No off target data available for this crispr