ID: 1018937628

View in Genome Browser
Species Human (GRCh38)
Location 6:168284016-168284038
Sequence ATCATGGAGCACCCTGCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018937628_1018937639 25 Left 1018937628 6:168284016-168284038 CCGGGTGCAGGGTGCTCCATGAT No data
Right 1018937639 6:168284064-168284086 TGGAAGGTAGGAGCGTGTGCCGG No data
1018937628_1018937633 -7 Left 1018937628 6:168284016-168284038 CCGGGTGCAGGGTGCTCCATGAT No data
Right 1018937633 6:168284032-168284054 CCATGATCACCCGAGGGGCACGG No data
1018937628_1018937640 26 Left 1018937628 6:168284016-168284038 CCGGGTGCAGGGTGCTCCATGAT No data
Right 1018937640 6:168284065-168284087 GGAAGGTAGGAGCGTGTGCCGGG No data
1018937628_1018937636 5 Left 1018937628 6:168284016-168284038 CCGGGTGCAGGGTGCTCCATGAT No data
Right 1018937636 6:168284044-168284066 GAGGGGCACGGCTCTGAGCATGG No data
1018937628_1018937637 9 Left 1018937628 6:168284016-168284038 CCGGGTGCAGGGTGCTCCATGAT No data
Right 1018937637 6:168284048-168284070 GGCACGGCTCTGAGCATGGAAGG No data
1018937628_1018937638 13 Left 1018937628 6:168284016-168284038 CCGGGTGCAGGGTGCTCCATGAT No data
Right 1018937638 6:168284052-168284074 CGGCTCTGAGCATGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018937628 Original CRISPR ATCATGGAGCACCCTGCACC CGG (reversed) Intergenic
No off target data available for this crispr