ID: 1018938127

View in Genome Browser
Species Human (GRCh38)
Location 6:168287361-168287383
Sequence CCTTCTTTGGATAAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018938127_1018938131 4 Left 1018938127 6:168287361-168287383 CCATCCATTTTATCCAAAGAAGG No data
Right 1018938131 6:168287388-168287410 TTAAAACTTCTGAGTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018938127 Original CRISPR CCTTCTTTGGATAAAATGGA TGG (reversed) Intergenic
No off target data available for this crispr