ID: 1018938149

View in Genome Browser
Species Human (GRCh38)
Location 6:168287516-168287538
Sequence CTGTTCCCATGGAGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018938142_1018938149 6 Left 1018938142 6:168287487-168287509 CCTGGTGGAGGAAACATCATCCT No data
Right 1018938149 6:168287516-168287538 CTGTTCCCATGGAGGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018938149 Original CRISPR CTGTTCCCATGGAGGTGACA GGG Intergenic
No off target data available for this crispr