ID: 1018939561

View in Genome Browser
Species Human (GRCh38)
Location 6:168300079-168300101
Sequence CCTTAGGACAACACTCCTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018939561_1018939570 20 Left 1018939561 6:168300079-168300101 CCGTAAGGAGTGTTGTCCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1018939570 6:168300122-168300144 AGGGCGTTCAAAGACTGCAGAGG No data
1018939561_1018939564 -8 Left 1018939561 6:168300079-168300101 CCGTAAGGAGTGTTGTCCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1018939564 6:168300094-168300116 TCCTAAGGCCAATGCGCTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 71
1018939561_1018939567 0 Left 1018939561 6:168300079-168300101 CCGTAAGGAGTGTTGTCCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1018939567 6:168300102-168300124 CCAATGCGCTGGAGGCACCGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1018939561_1018939568 1 Left 1018939561 6:168300079-168300101 CCGTAAGGAGTGTTGTCCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1018939568 6:168300103-168300125 CAATGCGCTGGAGGCACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018939561 Original CRISPR CCTTAGGACAACACTCCTTA CGG (reversed) Intronic
908965121 1:69751910-69751932 TCTTGGGACAAATCTCCTTATGG - Intronic
922524862 1:226293318-226293340 CCTGAGCACATCACTCCTTCTGG - Intronic
1063814211 10:9754758-9754780 CCTGACGACAACACTCCCCAGGG - Intergenic
1065167099 10:22991038-22991060 CTTTAGGACATCATTCCTTAGGG - Intronic
1067087791 10:43252044-43252066 CCCTCTGACAACACTCCTCATGG - Intronic
1067346389 10:45441713-45441735 CCTCTGGAACACACTCCTTATGG + Intronic
1078725826 11:13930038-13930060 CCCCAGGACGACTCTCCTTAAGG + Intergenic
1079710212 11:23673864-23673886 GCTTAGCACAAGACTACTTATGG - Intergenic
1093647272 12:21601363-21601385 CCTGGAGACAAAACTCCTTAAGG + Intronic
1094067110 12:26372979-26373001 CAGTAGGACAACACTGATTATGG - Intronic
1095973516 12:47922820-47922842 CCTTACCACATCACTCTTTATGG + Intronic
1097673220 12:62566941-62566963 TCTTAGGACAATATTCCTCAAGG + Intronic
1103213159 12:119181087-119181109 ACTTAAAACAACAATCCTTATGG - Intronic
1105822721 13:24094220-24094242 CCTCAGGATCACACTCCCTACGG - Intronic
1107906564 13:45066728-45066750 GCTTAGAACAACACTCATTTCGG + Intergenic
1124028059 15:25985255-25985277 CATTAGGAAAACATTGCTTATGG + Intergenic
1132134376 15:99320398-99320420 CCTTAGTAATACACTACTTAGGG - Intronic
1137371011 16:47905820-47905842 CCTCAGGCCAACATTCCTTTAGG - Intergenic
1148731787 17:49841353-49841375 CCTTAGGACCACCCCTCTTAAGG + Intronic
1149936829 17:60816077-60816099 CCTTAGGACATCCCTCCATTTGG + Intronic
1150006208 17:61470509-61470531 CACTAGAACAACACTCCTTGTGG + Intronic
1152946030 17:83197687-83197709 CCTGAGAAGAACAATCCTTAAGG - Intergenic
925202918 2:1983519-1983541 CCTTAGGACCACACACCATCAGG - Intronic
929245951 2:39703815-39703837 CCTAAACACAAAACTCCTTAAGG - Intronic
929683350 2:44012921-44012943 CCTCTGGTCAAAACTCCTTATGG + Intergenic
933467419 2:82672162-82672184 CCTTATGATAATGCTCCTTAAGG - Intergenic
933696235 2:85220171-85220193 CTTTAGGACAACATTACTTCTGG + Intronic
936562631 2:113554839-113554861 CCCATGGACAACACTACTTAAGG + Intergenic
940288700 2:152057195-152057217 CCTCAGTCCAACACACCTTAAGG + Intronic
944256442 2:197627641-197627663 CCTTAGGATACCACATCTTAAGG - Intronic
944631321 2:201628350-201628372 ACTTTGGACAACATTCCTTTGGG + Intronic
1171223112 20:23419458-23419480 TCTCAGGAGAACACTCCTTTTGG - Intronic
1173038284 20:39434122-39434144 CCTTAGGGCAACATGCTTTATGG + Intergenic
1177911591 21:27040061-27040083 TCTTAATACAACACTACTTAAGG + Intergenic
952796561 3:37243879-37243901 CCTTAGGAGAAAACTCTTAACGG - Intronic
953857229 3:46508686-46508708 CTTTAGGAGAAAACTCCTTGGGG - Intergenic
957631751 3:82724877-82724899 CAGTAGGACTACACTCCTTCTGG - Intergenic
961243045 3:125428955-125428977 CTTTAGGTCAACACTCTTAAAGG - Intergenic
964089399 3:152856848-152856870 CCTTTGAACAAATCTCCTTAGGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
978474054 4:109105742-109105764 CCTTGGGAGAACCATCCTTAAGG - Intronic
980146115 4:128986402-128986424 CCTTAGGACTGCAGTCCTTGTGG - Intronic
983640700 4:169941765-169941787 CCCTAGGCCCACACTCCTTGGGG + Intergenic
984103450 4:175515368-175515390 CCTTTGGAAAACATACCTTAGGG - Intergenic
985429565 4:189866371-189866393 CCTCTGGACAACACTCATTATGG - Intergenic
990566061 5:57030464-57030486 TCTTAAGACAACAGTCCTAAAGG - Intergenic
993582216 5:89677161-89677183 CCTTAGGGTATCAGTCCTTAGGG - Intergenic
993739070 5:91514679-91514701 CCTTAGGCCAACACACTTCACGG + Intergenic
994279847 5:97888666-97888688 CCTTAGTTCAACACTCCTCCTGG - Intergenic
1014995553 6:128138493-128138515 CCATAGGACAATAATCTTTAAGG - Intronic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1018546443 6:164941769-164941791 CCTTAGGCCAACACTCAAGAAGG - Intergenic
1018939561 6:168300079-168300101 CCTTAGGACAACACTCCTTACGG - Intronic
1022204073 7:28146613-28146635 CCTGAGGACAACTCTATTTAAGG - Intronic
1024818118 7:53294826-53294848 CTTTAGGATAACACTAATTAGGG - Intergenic
1026604829 7:71806834-71806856 CCCTAGCTCAACACTCCTCAGGG + Intronic
1027536743 7:79412846-79412868 CCTTAGGGCCACACACCTGAAGG - Intronic
1030498244 7:110327334-110327356 CCGTAGGACATTACTCCTAAGGG - Intergenic
1032749122 7:134819277-134819299 CCTTAGGATACCACTTCCTAAGG + Intronic
1032778660 7:135143787-135143809 CCTTAGGACAATTTTCCTAATGG - Intronic
1034144337 7:148855167-148855189 CCTAAGGCCAATAATCCTTATGG - Intronic
1041528546 8:58836552-58836574 TCCTAGGACAGCACTCCTTCAGG + Intronic
1048875508 8:138834096-138834118 CCTGAGGACAACACTCGTTCTGG + Intronic
1049890102 9:60858-60880 CCCATGGACAACACTACTTAAGG - Intergenic
1050056469 9:1660624-1660646 CCCTTTGACAACACTCCTTGGGG - Intergenic
1054696934 9:68369961-68369983 CCCATGGACAACACTACTTAAGG + Intronic
1188034090 X:25297330-25297352 CCTTAGCACAACACTGATCATGG - Intergenic
1188712298 X:33415669-33415691 CCTTAGGAGAAGACTCCTTGAGG - Intergenic
1199563544 X:149189758-149189780 CCTTAGCACAATACTTCATATGG + Intergenic