ID: 1018939909

View in Genome Browser
Species Human (GRCh38)
Location 6:168302150-168302172
Sequence GCTGGCTAATCAATAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018939909_1018939915 12 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939915 6:168302185-168302207 TCCTGGGTCTGGTCTCCCAGCGG 0: 1
1: 0
2: 2
3: 36
4: 385
1018939909_1018939919 24 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939919 6:168302197-168302219 TCTCCCAGCGGTTGGCAGCAGGG No data
1018939909_1018939917 16 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939917 6:168302189-168302211 GGGTCTGGTCTCCCAGCGGTTGG No data
1018939909_1018939911 -5 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939911 6:168302168-168302190 CCAGCTTGTCTATCCTTTCCTGG 0: 1
1: 0
2: 2
3: 12
4: 165
1018939909_1018939920 25 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939920 6:168302198-168302220 CTCCCAGCGGTTGGCAGCAGGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1018939909_1018939912 -4 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939912 6:168302169-168302191 CAGCTTGTCTATCCTTTCCTGGG No data
1018939909_1018939918 23 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939918 6:168302196-168302218 GTCTCCCAGCGGTTGGCAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1018939909_1018939913 1 Left 1018939909 6:168302150-168302172 CCTTGGGTTATTGATTAGCCAGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1018939913 6:168302174-168302196 TGTCTATCCTTTCCTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018939909 Original CRISPR GCTGGCTAATCAATAACCCA AGG (reversed) Intronic
905857779 1:41325987-41326009 GATGGCTAATCTATGCCCCACGG + Intergenic
911497512 1:98649920-98649942 GCTGGCAAAGCAACACCCCAAGG - Intergenic
913683315 1:121207438-121207460 GCTGGCTCTTCAGTCACCCATGG - Intronic
914035156 1:143995062-143995084 GCTGGCTCTTCAGTCACCCATGG - Intergenic
914154296 1:145072908-145072930 GCTGGCTCTTCAGTCACCCATGG + Intronic
914876140 1:151513741-151513763 GCAGGCTAATGAGTAACTCAGGG + Intronic
915276878 1:154795205-154795227 GCTGGCTAACCAAAAACTGAAGG + Intronic
918181726 1:182090192-182090214 GATGACTACTCACTAACCCAGGG + Intergenic
919814150 1:201427205-201427227 AGTGGCTCAGCAATAACCCAGGG + Intronic
920470623 1:206225948-206225970 GCTGGCTCTTCAGTCACCCATGG - Intronic
921625533 1:217374112-217374134 GCTGGCAAAGCAACACCCCAAGG + Intergenic
924952350 1:248896763-248896785 GCTGGCTAGGCAGTGACCCATGG + Intergenic
1064936583 10:20685217-20685239 GCTGGCTAATTATTAATACATGG + Intergenic
1065201307 10:23315989-23316011 GCTGGCAAAGCAACACCCCAAGG - Intronic
1068013257 10:51481456-51481478 CCAGGCTAATCTCTAACCCATGG + Intronic
1075918208 10:126187977-126187999 GCTGGCTAATCAGACACCTAAGG + Intronic
1077840514 11:5969566-5969588 GCTGGATAATCCATAAGTCAGGG - Intergenic
1077938998 11:6819350-6819372 GCTGGCAAAACAACATCCCAAGG + Intergenic
1078064367 11:8068304-8068326 GCAGGCTCTTCAATAGCCCAGGG - Intronic
1085064998 11:73486992-73487014 GCTGGTTAAAAAATAATCCATGG - Intronic
1086268093 11:85027390-85027412 GCTGGCAAATCGACATCCCAAGG - Intronic
1088552158 11:111024003-111024025 GTTGACTAATGAATCACCCAAGG + Intergenic
1093871253 12:24294257-24294279 GCTGCCTCATCAGTAACTCATGG + Intergenic
1099060904 12:77907138-77907160 GCTAGCTACTCAATAAACAAAGG + Intronic
1099713917 12:86265328-86265350 GCTGGCGAAACAACACCCCAAGG + Intronic
1100591833 12:96036701-96036723 GCTGGCTAGTCATTAACCAGAGG + Intronic
1106253357 13:28001003-28001025 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1107601975 13:42022886-42022908 GGTGGCTAATCAAAAACCAGAGG + Intergenic
1108559200 13:51626785-51626807 GCTGGCAAAGCAACACCCCAAGG - Intronic
1113014273 13:105809615-105809637 ACTAGCCAATCAATAACTCAAGG - Intergenic
1119985754 14:79135484-79135506 GCTTGCTAAGCAATACCCCAAGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1131046597 15:89320468-89320490 GCTGCATAATCAATAATACAGGG - Intronic
1137344007 16:47637510-47637532 GCTGGCAAAGCAACACCCCAAGG + Intronic
1144553466 17:16261332-16261354 GCTGGCGAAGCAACACCCCAAGG + Intronic
1146087094 17:29839395-29839417 GCTGGCAAAGCAACACCCCAAGG + Intronic
1150660836 17:67076591-67076613 GCTTGCTAACCATTAACCAAAGG + Exonic
1152530625 17:80916629-80916651 GCTGGCAAAGCAATACCCCAAGG + Intronic
1152864050 17:82711729-82711751 GCTGGCGAAGCAACACCCCAAGG - Intergenic
1153724135 18:7937625-7937647 GCTGGCGAAGCAACACCCCAAGG + Intronic
1155376396 18:25163113-25163135 GCTTTCTAATCAATGAACCAAGG + Intronic
1159146776 18:64464841-64464863 GGTGCTTAATCAATAACCGAAGG - Intergenic
1159833262 18:73304241-73304263 GCTGCCTAATCAAAAAACAATGG + Intergenic
925064238 2:916793-916815 GCAGGCTCATCAATGACTCATGG + Intergenic
926533217 2:14078191-14078213 GCTGGCTAATAACTTTCCCAGGG + Intergenic
928315670 2:30243460-30243482 TCTGGCTCATGAATAACTCATGG + Intronic
931300670 2:60974955-60974977 GCTGGCGAAGCAACACCCCAAGG + Intronic
935705124 2:105849951-105849973 GCTGCCTCTTCAATAGCCCAGGG - Intronic
936401223 2:112165863-112165885 GTTGGCTTTTCAAAAACCCATGG + Intronic
936789759 2:116137670-116137692 GCGAGCAAATCAATAAACCAGGG - Intergenic
937163879 2:119794240-119794262 GCTGGCTAAGCAATATCCCACGG - Intronic
941333072 2:164204573-164204595 GCTGGTGAAACAAAAACCCAAGG + Intergenic
945018057 2:205540812-205540834 GCTGGCTGAACACAAACCCATGG - Intronic
947190471 2:227499798-227499820 GCTGGATAATCTATAACCTGGGG + Intronic
1171539825 20:25940099-25940121 GCTTGCCAATGAATAACCAAGGG - Intergenic
1172899972 20:38327566-38327588 GCTGCCAAAACAACAACCCAGGG - Exonic
1176878330 21:14158330-14158352 GCGTGCTTATAAATAACCCATGG + Intronic
1182215251 22:28711275-28711297 TATGGCTAATCCATAAACCAGGG + Intronic
950617265 3:14171117-14171139 GCTGGCTAAACAATGGCTCAAGG + Intronic
953690496 3:45113758-45113780 GCTGTCTAACCAATAACACAGGG + Intronic
954921182 3:54192474-54192496 TCTGGGTTTTCAATAACCCAAGG - Intronic
956453592 3:69398721-69398743 GCTGGATAAGCCATAACTCATGG + Intronic
957987739 3:87593119-87593141 TCTGACTAATCAATAGCACAAGG + Intergenic
958047023 3:88297332-88297354 GGTGGCTAATCATTCTCCCAAGG + Intergenic
961918599 3:130403043-130403065 GCTGGCTGATCAGTATACCAGGG - Intronic
962173274 3:133125457-133125479 GCTGGATAATCAATTAATCAGGG - Intronic
964827687 3:160848337-160848359 GCTGGGTCAACAACAACCCAGGG + Intronic
967662227 3:192127004-192127026 GTTGGTTAATCAAAAAACCAGGG + Intergenic
971468011 4:26986131-26986153 GCTTCCTAATCTATAAACCAAGG + Intronic
972944082 4:44231899-44231921 GCTGGCTACTCAAAAACTCGAGG + Intronic
975498468 4:75058870-75058892 GCTGGCAAAACAACACCCCAAGG + Intergenic
977869610 4:102075416-102075438 GCTGGTAAATTAATAACCTAAGG - Intergenic
981598097 4:146449864-146449886 TCTAGCTATTAAATAACCCAGGG - Intronic
983885258 4:172974575-172974597 GCTGGCAAAACAACACCCCAAGG - Intronic
990878931 5:60518357-60518379 GCTGGCAAAGCAACACCCCAAGG + Intronic
992838760 5:80667404-80667426 GCTGGCGAAGCAACACCCCAAGG - Intronic
995386490 5:111595479-111595501 GCTGGCAAAGCAAGACCCCAAGG - Intergenic
995728069 5:115203151-115203173 GCTGGCAAGTCAACAAGCCAGGG + Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1000649163 5:163794584-163794606 GCTGGCTGAGAAATTACCCATGG - Intergenic
1001330382 5:170758204-170758226 GCTGGCAAATCAATAACCTCTGG + Intergenic
1002386851 5:178874799-178874821 TCTGGCAAATCAAAAACCCAGGG - Intronic
1004297481 6:14426607-14426629 TCTGGCTTGTCAGTAACCCAGGG - Intergenic
1005594866 6:27369173-27369195 GCTGGCGAAGCAATAACCCAAGG + Intergenic
1010847046 6:80721166-80721188 GCTGGCCAAACAACACCCCAAGG + Intergenic
1010887474 6:81262692-81262714 GCTGGTGAAGCGATAACCCAAGG - Intergenic
1011284013 6:85705248-85705270 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1016365342 6:143310377-143310399 GCACACTAATAAATAACCCATGG + Intronic
1018939909 6:168302150-168302172 GCTGGCTAATCAATAACCCAAGG - Intronic
1021117693 7:16762433-16762455 GGTGGCTAATGAATAACCTCGGG + Intronic
1028034991 7:85971538-85971560 ACTGGCCAAGCAACAACCCAGGG - Intergenic
1028378750 7:90175699-90175721 GCTGGCAAAGCAACACCCCAAGG - Intronic
1030169056 7:106583342-106583364 GCTGGATAATCAAAGACACATGG + Intergenic
1032858466 7:135857095-135857117 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1034210254 7:149357233-149357255 GCTGGCAAAGCAACACCCCAGGG - Intergenic
1035105197 7:156436271-156436293 GTTAACTGATCAATAACCCATGG + Intergenic
1036020614 8:4841266-4841288 TAAGGCTAATCAATAACCAAAGG - Intronic
1041274567 8:56143452-56143474 GCTGGCGAAGCAACACCCCAAGG + Intergenic
1043737544 8:83767604-83767626 GCTGGAAAAACAACAACCCAAGG - Intergenic
1045888186 8:107123899-107123921 GCTGGTGAAGCAACAACCCAAGG + Intergenic
1046222754 8:111236838-111236860 ACTGACTAATAAATAGCCCATGG + Intergenic
1047797259 8:128270428-128270450 ACTGACTCTTCAATAACCCATGG + Intergenic
1058545609 9:106058437-106058459 GCTGGTGAAGCAATACCCCAAGG - Intergenic
1058625797 9:106931662-106931684 CCTGTGTAATCAGTAACCCAAGG + Intronic
1188207941 X:27381799-27381821 GCTGGCAAATCGATACCCCAAGG + Intergenic